Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627167_a_at:

>probe:Drosophila_2:1627167_a_at:720:303; Interrogation_Position=144; Antisense; CCGTCGAATGGACCGCTTGGAGCAA
>probe:Drosophila_2:1627167_a_at:588:267; Interrogation_Position=187; Antisense; CAGGATCGGCGATCGCGATTGCGTA
>probe:Drosophila_2:1627167_a_at:543:441; Interrogation_Position=232; Antisense; GATGTGTCATCCGTAAACGCGGTCT
>probe:Drosophila_2:1627167_a_at:584:175; Interrogation_Position=246; Antisense; AAACGCGGTCTTTGACGCGGTGCAG
>probe:Drosophila_2:1627167_a_at:697:519; Interrogation_Position=286; Antisense; GTGGACATTCTTATCAATAACGCCG
>probe:Drosophila_2:1627167_a_at:34:559; Interrogation_Position=325; Antisense; GGACAGCTGCTGACTATGTCGGTAG
>probe:Drosophila_2:1627167_a_at:376:61; Interrogation_Position=340; Antisense; ATGTCGGTAGACACTGTGCAGCAGA
>probe:Drosophila_2:1627167_a_at:281:491; Interrogation_Position=378; Antisense; TGTAATGGGCGTGGTCTACTGCACC
>probe:Drosophila_2:1627167_a_at:641:123; Interrogation_Position=404; Antisense; AGCGCGCCTTTGAATCGATGCGGCA
>probe:Drosophila_2:1627167_a_at:218:505; Interrogation_Position=435; Antisense; GTCCAAGGGTCATGTGGTGCTCATT
>probe:Drosophila_2:1627167_a_at:67:517; Interrogation_Position=469; Antisense; GTGGGTCACTACATCTTTAATCCCC
>probe:Drosophila_2:1627167_a_at:388:709; Interrogation_Position=485; Antisense; TTAATCCCCTGCCTGGAAGTCAGCA
>probe:Drosophila_2:1627167_a_at:284:115; Interrogation_Position=506; Antisense; AGCAGGAACTCAACATGTACCCGGC
>probe:Drosophila_2:1627167_a_at:2:709; Interrogation_Position=554; Antisense; TTACCGAGCTCTTTCGCCAGGAGAT

Paste this into a BLAST search page for me
CCGTCGAATGGACCGCTTGGAGCAACAGGATCGGCGATCGCGATTGCGTAGATGTGTCATCCGTAAACGCGGTCTAAACGCGGTCTTTGACGCGGTGCAGGTGGACATTCTTATCAATAACGCCGGGACAGCTGCTGACTATGTCGGTAGATGTCGGTAGACACTGTGCAGCAGATGTAATGGGCGTGGTCTACTGCACCAGCGCGCCTTTGAATCGATGCGGCAGTCCAAGGGTCATGTGGTGCTCATTGTGGGTCACTACATCTTTAATCCCCTTAATCCCCTGCCTGGAAGTCAGCAAGCAGGAACTCAACATGTACCCGGCTTACCGAGCTCTTTCGCCAGGAGAT

Full Affymetrix probeset data:

Annotations for 1627167_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime