FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627168_at:

>probe:Drosophila_2:1627168_at:344:21; Interrogation_Position=105; Antisense; ATTTGGCTGCAATGTCTTCGGGAAA
>probe:Drosophila_2:1627168_at:124:167; Interrogation_Position=128; Antisense; AAATGCCACCAATATGCGCCTGGAG
>probe:Drosophila_2:1627168_at:645:77; Interrogation_Position=157; Antisense; AGGATCTGGGACGTCGCATTGCTGT
>probe:Drosophila_2:1627168_at:182:345; Interrogation_Position=172; Antisense; GCATTGCTGTTTCTTTGGCCAGTTC
>probe:Drosophila_2:1627168_at:77:315; Interrogation_Position=189; Antisense; GCCAGTTCCCAGAAAGCTCTAGTTG
>probe:Drosophila_2:1627168_at:203:373; Interrogation_Position=296; Antisense; GAAGTGTTGTGAATTGCTCCTGGAA
>probe:Drosophila_2:1627168_at:126:387; Interrogation_Position=341; Antisense; GAACAACGACCTGGATGCCGAACTA
>probe:Drosophila_2:1627168_at:28:443; Interrogation_Position=376; Antisense; GATGTGCCGGATTCTATTGATATAA
>probe:Drosophila_2:1627168_at:86:165; Interrogation_Position=428; Antisense; AAATAGGATCCAAGACCGCACCAAT
>probe:Drosophila_2:1627168_at:561:411; Interrogation_Position=441; Antisense; GACCGCACCAATTCGATTACTAACG
>probe:Drosophila_2:1627168_at:657:709; Interrogation_Position=473; Antisense; TTAATGCGTTGTCAATTCCACCTCA
>probe:Drosophila_2:1627168_at:398:653; Interrogation_Position=484; Antisense; TCAATTCCACCTCACACATTTAAAA
>probe:Drosophila_2:1627168_at:526:533; Interrogation_Position=519; Antisense; GGTGGTCAGGGCTACAAATGTTTTA
>probe:Drosophila_2:1627168_at:711:67; Interrogation_Position=90; Antisense; ATGGCCAAGCGTTCTATTTGGCTGC

Paste this into a BLAST search page for me
ATTTGGCTGCAATGTCTTCGGGAAAAAATGCCACCAATATGCGCCTGGAGAGGATCTGGGACGTCGCATTGCTGTGCATTGCTGTTTCTTTGGCCAGTTCGCCAGTTCCCAGAAAGCTCTAGTTGGAAGTGTTGTGAATTGCTCCTGGAAGAACAACGACCTGGATGCCGAACTAGATGTGCCGGATTCTATTGATATAAAAATAGGATCCAAGACCGCACCAATGACCGCACCAATTCGATTACTAACGTTAATGCGTTGTCAATTCCACCTCATCAATTCCACCTCACACATTTAAAAGGTGGTCAGGGCTACAAATGTTTTAATGGCCAAGCGTTCTATTTGGCTGC

Full Affymetrix probeset data:

Annotations for 1627168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720