FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627169_at:

>probe:Drosophila_2:1627169_at:435:187; Interrogation_Position=1104; Antisense; AACACGGATACTTTGCGTTCATTGA
>probe:Drosophila_2:1627169_at:61:681; Interrogation_Position=1145; Antisense; TATGGCAACCACTACACCAAAGCTG
>probe:Drosophila_2:1627169_at:287:125; Interrogation_Position=1160; Antisense; ACCAAAGCTGGCTATGCTCTGGATG
>probe:Drosophila_2:1627169_at:102:95; Interrogation_Position=1212; Antisense; AGTTGGCCCGTGACATGACGGACAT
>probe:Drosophila_2:1627169_at:155:553; Interrogation_Position=1240; Antisense; GGACACTTTAATTGTGGTGACCGCT
>probe:Drosophila_2:1627169_at:702:345; Interrogation_Position=1284; Antisense; GCATAGCCGGCTATCCTGGCAGAGG
>probe:Drosophila_2:1627169_at:702:435; Interrogation_Position=1305; Antisense; GAGGAACACCCATCCTGGGAATCAA
>probe:Drosophila_2:1627169_at:708:431; Interrogation_Position=1353; Antisense; GAGTGCAGTACTCGGTTCTGAACTA
>probe:Drosophila_2:1627169_at:458:715; Interrogation_Position=1368; Antisense; TTCTGAACTATGCAGCTGGACCCAA
>probe:Drosophila_2:1627169_at:245:609; Interrogation_Position=1405; Antisense; TGAGAACGGACAGCGCATTCCTTTG
>probe:Drosophila_2:1627169_at:526:691; Interrogation_Position=1426; Antisense; TTTGGACGATATCCTTGGCTCGGAC
>probe:Drosophila_2:1627169_at:726:147; Interrogation_Position=1470; Antisense; ACATTCCCAAGGATCAGGGCGTCCA
>probe:Drosophila_2:1627169_at:263:75; Interrogation_Position=1503; Antisense; AGGACGTGGGCATATTCGCCTCCGG
>probe:Drosophila_2:1627169_at:361:39; Interrogation_Position=1578; Antisense; ATCTGATGGCATATGCTGCGTGCAT

Paste this into a BLAST search page for me
AACACGGATACTTTGCGTTCATTGATATGGCAACCACTACACCAAAGCTGACCAAAGCTGGCTATGCTCTGGATGAGTTGGCCCGTGACATGACGGACATGGACACTTTAATTGTGGTGACCGCTGCATAGCCGGCTATCCTGGCAGAGGGAGGAACACCCATCCTGGGAATCAAGAGTGCAGTACTCGGTTCTGAACTATTCTGAACTATGCAGCTGGACCCAATGAGAACGGACAGCGCATTCCTTTGTTTGGACGATATCCTTGGCTCGGACACATTCCCAAGGATCAGGGCGTCCAAGGACGTGGGCATATTCGCCTCCGGATCTGATGGCATATGCTGCGTGCAT

Full Affymetrix probeset data:

Annotations for 1627169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720