FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627171_at:

>probe:Drosophila_2:1627171_at:44:97; Interrogation_Position=114; Antisense; AGATCCCGTGCTTTCGTAACAGTTT
>probe:Drosophila_2:1627171_at:558:153; Interrogation_Position=132; Antisense; ACAGTTTTCTCTACGGAATCAGCGG
>probe:Drosophila_2:1627171_at:177:649; Interrogation_Position=150; Antisense; TCAGCGGAGGAATCGGCATCGGCTT
>probe:Drosophila_2:1627171_at:621:41; Interrogation_Position=167; Antisense; ATCGGCTTGCTGACTTTTCTGGGCA
>probe:Drosophila_2:1627171_at:606:129; Interrogation_Position=263; Antisense; ACCTGCAGGTATCAATGGTCCGTCA
>probe:Drosophila_2:1627171_at:50:537; Interrogation_Position=279; Antisense; GGTCCGTCAGGAGATTCGAGCAGCA
>probe:Drosophila_2:1627171_at:214:327; Interrogation_Position=317; Antisense; GCGATGAGACGACAAGCCCTTTATG
>probe:Drosophila_2:1627171_at:206:501; Interrogation_Position=376; Antisense; GTCGGCGTAGCATAAGTCAGATCCT
>probe:Drosophila_2:1627171_at:639:495; Interrogation_Position=391; Antisense; GTCAGATCCTTCATTACTACTTCGA
>probe:Drosophila_2:1627171_at:187:443; Interrogation_Position=414; Antisense; GATGTTTGTTTTCACTCTAGGATAC
>probe:Drosophila_2:1627171_at:259:569; Interrogation_Position=450; Antisense; GGCATTGTTAAATCCCTTGTGTTGT
>probe:Drosophila_2:1627171_at:42:617; Interrogation_Position=47; Antisense; TGCAGCATGGCCGAAGAACCCGAGG
>probe:Drosophila_2:1627171_at:683:437; Interrogation_Position=68; Antisense; GAGGAACCCGCCAAGAGCTTCGTTA
>probe:Drosophila_2:1627171_at:220:101; Interrogation_Position=81; Antisense; AGAGCTTCGTTATCTTCGGACGCGA

Paste this into a BLAST search page for me
AGATCCCGTGCTTTCGTAACAGTTTACAGTTTTCTCTACGGAATCAGCGGTCAGCGGAGGAATCGGCATCGGCTTATCGGCTTGCTGACTTTTCTGGGCAACCTGCAGGTATCAATGGTCCGTCAGGTCCGTCAGGAGATTCGAGCAGCAGCGATGAGACGACAAGCCCTTTATGGTCGGCGTAGCATAAGTCAGATCCTGTCAGATCCTTCATTACTACTTCGAGATGTTTGTTTTCACTCTAGGATACGGCATTGTTAAATCCCTTGTGTTGTTGCAGCATGGCCGAAGAACCCGAGGGAGGAACCCGCCAAGAGCTTCGTTAAGAGCTTCGTTATCTTCGGACGCGA

Full Affymetrix probeset data:

Annotations for 1627171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720