FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627173_at:

>probe:Drosophila_2:1627173_at:500:237; Interrogation_Position=1421; Antisense; AATCTCGACGACAAATGCCGCGATT
>probe:Drosophila_2:1627173_at:366:293; Interrogation_Position=1441; Antisense; CGATTGCCGTGTCCGTTAAGTCCAA
>probe:Drosophila_2:1627173_at:151:647; Interrogation_Position=1523; Antisense; TCATAATCATCACAGCGATCGCGGC
>probe:Drosophila_2:1627173_at:179:593; Interrogation_Position=1556; Antisense; TGGTGGATCCAATCAGCAGGACTCT
>probe:Drosophila_2:1627173_at:281:695; Interrogation_Position=1583; Antisense; TTTCGATGAGTTCAGCTCGCAGGAC
>probe:Drosophila_2:1627173_at:672:509; Interrogation_Position=1710; Antisense; GTGCAGACGCAGCATTTCTATCAGA
>probe:Drosophila_2:1627173_at:67:383; Interrogation_Position=1763; Antisense; GAACGGATCCGTTCCGATACTGGGA
>probe:Drosophila_2:1627173_at:119:29; Interrogation_Position=1779; Antisense; ATACTGGGACGCTGCAAGGCACTGT
>probe:Drosophila_2:1627173_at:63:225; Interrogation_Position=1794; Antisense; AAGGCACTGTATAGCTACACCCCGA
>probe:Drosophila_2:1627173_at:249:671; Interrogation_Position=1824; Antisense; TACGACGAGCTGGAACTGAGTCCCG
>probe:Drosophila_2:1627173_at:38:609; Interrogation_Position=1840; Antisense; TGAGTCCCGGCGACATCATCGAGGT
>probe:Drosophila_2:1627173_at:2:37; Interrogation_Position=1854; Antisense; ATCATCGAGGTGCATGCCAAACAGG
>probe:Drosophila_2:1627173_at:527:61; Interrogation_Position=1936; Antisense; ATGTGGAGGAGTGCGCCTAGTTCTA
>probe:Drosophila_2:1627173_at:185:469; Interrogation_Position=1955; Antisense; GTTCTAGTTGGGAAACGCCCTGCCA

Paste this into a BLAST search page for me
AATCTCGACGACAAATGCCGCGATTCGATTGCCGTGTCCGTTAAGTCCAATCATAATCATCACAGCGATCGCGGCTGGTGGATCCAATCAGCAGGACTCTTTTCGATGAGTTCAGCTCGCAGGACGTGCAGACGCAGCATTTCTATCAGAGAACGGATCCGTTCCGATACTGGGAATACTGGGACGCTGCAAGGCACTGTAAGGCACTGTATAGCTACACCCCGATACGACGAGCTGGAACTGAGTCCCGTGAGTCCCGGCGACATCATCGAGGTATCATCGAGGTGCATGCCAAACAGGATGTGGAGGAGTGCGCCTAGTTCTAGTTCTAGTTGGGAAACGCCCTGCCA

Full Affymetrix probeset data:

Annotations for 1627173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720