Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627174_at:

>probe:Drosophila_2:1627174_at:711:337; Interrogation_Position=105; Antisense; GCTCTGCTTGCCCTTTGGCAAAATC
>probe:Drosophila_2:1627174_at:184:49; Interrogation_Position=127; Antisense; ATCCTTGGCTCGCTGATCGTTGATA
>probe:Drosophila_2:1627174_at:568:727; Interrogation_Position=131; Antisense; TTGGCTCGCTGATCGTTGATAACGA
>probe:Drosophila_2:1627174_at:190:195; Interrogation_Position=151; Antisense; AACGAAGGGTTCATCCAGTTTGCTA
>probe:Drosophila_2:1627174_at:104:81; Interrogation_Position=156; Antisense; AGGGTTCATCCAGTTTGCTAGGGAG
>probe:Drosophila_2:1627174_at:87:697; Interrogation_Position=16; Antisense; TTTAGAAACGATATCCCGGCACCGA
>probe:Drosophila_2:1627174_at:581:417; Interrogation_Position=180; Antisense; GAGCGAGGCCACGAGCGCCATAGAC
>probe:Drosophila_2:1627174_at:256:315; Interrogation_Position=196; Antisense; GCCATAGACGCGCTCGACCAAATTG
>probe:Drosophila_2:1627174_at:349:323; Interrogation_Position=205; Antisense; GCGCTCGACCAAATTGTCTTCAAAT
>probe:Drosophila_2:1627174_at:354:695; Interrogation_Position=259; Antisense; TTTCCTCCAATCGAAGGCGGTCAGG
>probe:Drosophila_2:1627174_at:291:249; Interrogation_Position=266; Antisense; CAATCGAAGGCGGTCAGGTGTTAGT
>probe:Drosophila_2:1627174_at:385:441; Interrogation_Position=304; Antisense; GATGGAGTATACTTCGAGGATGAAT
>probe:Drosophila_2:1627174_at:615:451; Interrogation_Position=57; Antisense; GATCTGGGTGAGAAACCTACCGCCT
>probe:Drosophila_2:1627174_at:81:269; Interrogation_Position=91; Antisense; CAGGAGCTGGTTATGCTCTGCTTGC

Paste this into a BLAST search page for me
GCTCTGCTTGCCCTTTGGCAAAATCATCCTTGGCTCGCTGATCGTTGATATTGGCTCGCTGATCGTTGATAACGAAACGAAGGGTTCATCCAGTTTGCTAAGGGTTCATCCAGTTTGCTAGGGAGTTTAGAAACGATATCCCGGCACCGAGAGCGAGGCCACGAGCGCCATAGACGCCATAGACGCGCTCGACCAAATTGGCGCTCGACCAAATTGTCTTCAAATTTTCCTCCAATCGAAGGCGGTCAGGCAATCGAAGGCGGTCAGGTGTTAGTGATGGAGTATACTTCGAGGATGAATGATCTGGGTGAGAAACCTACCGCCTCAGGAGCTGGTTATGCTCTGCTTGC

Full Affymetrix probeset data:

Annotations for 1627174_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime