FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627175_at:

>probe:Drosophila_2:1627175_at:19:235; Interrogation_Position=1311; Antisense; AATGCGATCGCCAATTAAGTCCCTT
>probe:Drosophila_2:1627175_at:535:87; Interrogation_Position=1328; Antisense; AGTCCCTTAGCGAGGTGCTGGCCAA
>probe:Drosophila_2:1627175_at:488:557; Interrogation_Position=1353; Antisense; GGACTATGAGTTCCGTATTCTGCCC
>probe:Drosophila_2:1627175_at:51:623; Interrogation_Position=1425; Antisense; TGCGGTGCTCTCACTTGAGGAGTCA
>probe:Drosophila_2:1627175_at:675:549; Interrogation_Position=1443; Antisense; GGAGTCACTGTACCGACTACGTGAT
>probe:Drosophila_2:1627175_at:404:79; Interrogation_Position=1479; Antisense; AGGTATTACAGTGGCTCTTCTACAG
>probe:Drosophila_2:1627175_at:149:653; Interrogation_Position=1511; Antisense; TCAACCAGTTTGACTTTCGTTCGGG
>probe:Drosophila_2:1627175_at:506:707; Interrogation_Position=1588; Antisense; TTAACCTTTTACATGCGACCGCATT
>probe:Drosophila_2:1627175_at:481:367; Interrogation_Position=1628; Antisense; GAATCGATCGTCTAATCATGGCCAT
>probe:Drosophila_2:1627175_at:174:347; Interrogation_Position=1664; Antisense; GCATCGTTGCCCGTTATCGAAAGAT
>probe:Drosophila_2:1627175_at:123:205; Interrogation_Position=1738; Antisense; AAGCCATTGTCCATCTGGCGACTAA
>probe:Drosophila_2:1627175_at:102:349; Interrogation_Position=1783; Antisense; GCAGGGCTATATCTTGTGGCCTTAA
>probe:Drosophila_2:1627175_at:479:581; Interrogation_Position=1799; Antisense; TGGCCTTAATTGTCTTCATCCTGGA
>probe:Drosophila_2:1627175_at:339:375; Interrogation_Position=1844; Antisense; GAAGATTACGCAGGGCTTTCAATGT

Paste this into a BLAST search page for me
AATGCGATCGCCAATTAAGTCCCTTAGTCCCTTAGCGAGGTGCTGGCCAAGGACTATGAGTTCCGTATTCTGCCCTGCGGTGCTCTCACTTGAGGAGTCAGGAGTCACTGTACCGACTACGTGATAGGTATTACAGTGGCTCTTCTACAGTCAACCAGTTTGACTTTCGTTCGGGTTAACCTTTTACATGCGACCGCATTGAATCGATCGTCTAATCATGGCCATGCATCGTTGCCCGTTATCGAAAGATAAGCCATTGTCCATCTGGCGACTAAGCAGGGCTATATCTTGTGGCCTTAATGGCCTTAATTGTCTTCATCCTGGAGAAGATTACGCAGGGCTTTCAATGT

Full Affymetrix probeset data:

Annotations for 1627175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720