FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627176_at:

>probe:Drosophila_2:1627176_at:707:697; Interrogation_Position=1017; Antisense; TTTAGCAACCATATTGTCCGGTACA
>probe:Drosophila_2:1627176_at:549:151; Interrogation_Position=1050; Antisense; ACATATGAACTACTGTCCACCGATC
>probe:Drosophila_2:1627176_at:355:607; Interrogation_Position=1084; Antisense; TGATGGCACCCCAGATATATCTCAG
>probe:Drosophila_2:1627176_at:699:427; Interrogation_Position=1130; Antisense; GAGATTACGAGATGCCGGACACTAC
>probe:Drosophila_2:1627176_at:510:31; Interrogation_Position=1183; Antisense; ATAAGATCCGCGAGGCTTTCCTGGA
>probe:Drosophila_2:1627176_at:132:73; Interrogation_Position=1195; Antisense; AGGCTTTCCTGGATGTGCTGGCCGA
>probe:Drosophila_2:1627176_at:507:55; Interrogation_Position=1243; Antisense; ATGAGTACTGGTCGGACTACGGTAA
>probe:Drosophila_2:1627176_at:344:719; Interrogation_Position=1282; Antisense; TTCCGACTAGCGATCGACGGGAGTT
>probe:Drosophila_2:1627176_at:74:621; Interrogation_Position=1312; Antisense; TGCTCTTCCTTATGCCACTGGGATT
>probe:Drosophila_2:1627176_at:196:593; Interrogation_Position=1330; Antisense; TGGGATTGGCTCTTCTTCCATTGAC
>probe:Drosophila_2:1627176_at:447:607; Interrogation_Position=1351; Antisense; TGACCGTGTGGTTCAGTTATCTGTT
>probe:Drosophila_2:1627176_at:87:491; Interrogation_Position=1376; Antisense; GTACAAACGTTGCTCTGTGGGACAC
>probe:Drosophila_2:1627176_at:360:527; Interrogation_Position=1394; Antisense; GGGACACGGCGATTGCCAGCGAATA
>probe:Drosophila_2:1627176_at:669:351; Interrogation_Position=999; Antisense; GCACCCACAACCTCAAATTTTAGCA

Paste this into a BLAST search page for me
TTTAGCAACCATATTGTCCGGTACAACATATGAACTACTGTCCACCGATCTGATGGCACCCCAGATATATCTCAGGAGATTACGAGATGCCGGACACTACATAAGATCCGCGAGGCTTTCCTGGAAGGCTTTCCTGGATGTGCTGGCCGAATGAGTACTGGTCGGACTACGGTAATTCCGACTAGCGATCGACGGGAGTTTGCTCTTCCTTATGCCACTGGGATTTGGGATTGGCTCTTCTTCCATTGACTGACCGTGTGGTTCAGTTATCTGTTGTACAAACGTTGCTCTGTGGGACACGGGACACGGCGATTGCCAGCGAATAGCACCCACAACCTCAAATTTTAGCA

Full Affymetrix probeset data:

Annotations for 1627176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720