Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627179_s_at:

>probe:Drosophila_2:1627179_s_at:230:267; Interrogation_Position=13; Antisense; CCTCAGCGTAATATTTAATTCGTAC
>probe:Drosophila_2:1627179_s_at:12:699; Interrogation_Position=193; Antisense; TTTAGCAAACAAATCAACAGACATT
>probe:Drosophila_2:1627179_s_at:422:675; Interrogation_Position=229; Antisense; TATTTATATGTACGTAGGAAGGCCC
>probe:Drosophila_2:1627179_s_at:546:599; Interrogation_Position=237; Antisense; TGTACGTAGGAAGGCCCAGATCGAA
>probe:Drosophila_2:1627179_s_at:121:563; Interrogation_Position=245; Antisense; GGAAGGCCCAGATCGAAATCAAATG
>probe:Drosophila_2:1627179_s_at:73:201; Interrogation_Position=271; Antisense; AACGCTTGAAATCAGACATCAGAGA
>probe:Drosophila_2:1627179_s_at:106:401; Interrogation_Position=285; Antisense; GACATCAGAGATCAGTAAACAGAGA
>probe:Drosophila_2:1627179_s_at:522:33; Interrogation_Position=337; Antisense; ATCAAAGATGATCAGCAATGAGCAA
>probe:Drosophila_2:1627179_s_at:350:209; Interrogation_Position=362; Antisense; AAGAAAAGCGGGTTGGCACCAAGCA
>probe:Drosophila_2:1627179_s_at:666:529; Interrogation_Position=371; Antisense; GGGTTGGCACCAAGCAAATGCTAAA
>probe:Drosophila_2:1627179_s_at:675:275; Interrogation_Position=51; Antisense; CTTTGTTCCGTTTGTGTTTGTATAT
>probe:Drosophila_2:1627179_s_at:18:515; Interrogation_Position=64; Antisense; GTGTTTGTATATTTTTTGCTCATAG
>probe:Drosophila_2:1627179_s_at:685:693; Interrogation_Position=78; Antisense; TTTGCTCATAGGAAAGCAGCGGCTA
>probe:Drosophila_2:1627179_s_at:524:113; Interrogation_Position=92; Antisense; AGCAGCGGCTAAGGGAGATCTTTGA

Paste this into a BLAST search page for me
CCTCAGCGTAATATTTAATTCGTACTTTAGCAAACAAATCAACAGACATTTATTTATATGTACGTAGGAAGGCCCTGTACGTAGGAAGGCCCAGATCGAAGGAAGGCCCAGATCGAAATCAAATGAACGCTTGAAATCAGACATCAGAGAGACATCAGAGATCAGTAAACAGAGAATCAAAGATGATCAGCAATGAGCAAAAGAAAAGCGGGTTGGCACCAAGCAGGGTTGGCACCAAGCAAATGCTAAACTTTGTTCCGTTTGTGTTTGTATATGTGTTTGTATATTTTTTGCTCATAGTTTGCTCATAGGAAAGCAGCGGCTAAGCAGCGGCTAAGGGAGATCTTTGA

Full Affymetrix probeset data:

Annotations for 1627179_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime