FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627180_at:

>probe:Drosophila_2:1627180_at:464:699; Interrogation_Position=1065; Antisense; TTTACCTGTTATTTGCTGGCTCGAC
>probe:Drosophila_2:1627180_at:510:397; Interrogation_Position=1143; Antisense; GACAAGTCGGCTCCAGTTACTATGA
>probe:Drosophila_2:1627180_at:325:653; Interrogation_Position=1171; Antisense; TACTCGGCGAGCTCAAGTACTTAGA
>probe:Drosophila_2:1627180_at:159:31; Interrogation_Position=1203; Antisense; ATAAAGGAGTCTCTGCGCCTGTTTC
>probe:Drosophila_2:1627180_at:502:535; Interrogation_Position=1232; Antisense; GGTGCCGATCATTGGACGCTACATT
>probe:Drosophila_2:1627180_at:410:605; Interrogation_Position=1285; Antisense; TGATACCCGCCGACTCGAATGTGAT
>probe:Drosophila_2:1627180_at:666:11; Interrogation_Position=1311; Antisense; ATTCTTATTTACCATGCTCAGCGCG
>probe:Drosophila_2:1627180_at:330:105; Interrogation_Position=1340; Antisense; AGACTACTTCCCTGATCCGGAGAAG
>probe:Drosophila_2:1627180_at:83:109; Interrogation_Position=1360; Antisense; AGAAGTTCATCCCTGATCGTTTCAG
>probe:Drosophila_2:1627180_at:588:123; Interrogation_Position=1390; Antisense; AGCGCAAGGGCGAGATCAGTCCATT
>probe:Drosophila_2:1627180_at:367:41; Interrogation_Position=1452; Antisense; ATCGGCCAAAAGTTCGCAATGCTCG
>probe:Drosophila_2:1627180_at:372:423; Interrogation_Position=1505; Antisense; GAGACACTTTGAGTTGCTGCCTCTG
>probe:Drosophila_2:1627180_at:443:487; Interrogation_Position=1548; Antisense; GTACTGAACGTTATCCTGCGCTCGA
>probe:Drosophila_2:1627180_at:725:303; Interrogation_Position=1576; Antisense; CCGGAATCAATTGTGGCCTCAAGCC

Paste this into a BLAST search page for me
TTTACCTGTTATTTGCTGGCTCGACGACAAGTCGGCTCCAGTTACTATGATACTCGGCGAGCTCAAGTACTTAGAATAAAGGAGTCTCTGCGCCTGTTTCGGTGCCGATCATTGGACGCTACATTTGATACCCGCCGACTCGAATGTGATATTCTTATTTACCATGCTCAGCGCGAGACTACTTCCCTGATCCGGAGAAGAGAAGTTCATCCCTGATCGTTTCAGAGCGCAAGGGCGAGATCAGTCCATTATCGGCCAAAAGTTCGCAATGCTCGGAGACACTTTGAGTTGCTGCCTCTGGTACTGAACGTTATCCTGCGCTCGACCGGAATCAATTGTGGCCTCAAGCC

Full Affymetrix probeset data:

Annotations for 1627180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720