FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627181_at:

>probe:Drosophila_2:1627181_at:596:217; Interrogation_Position=523; Antisense; AAGTAAGCATAAGCATCCTCCACCT
>probe:Drosophila_2:1627181_at:68:347; Interrogation_Position=535; Antisense; GCATCCTCCACCTCAAAGAAGAGTG
>probe:Drosophila_2:1627181_at:582:271; Interrogation_Position=560; Antisense; CATCGTGTGTGTTAGCAGGCGCGTA
>probe:Drosophila_2:1627181_at:310:53; Interrogation_Position=576; Antisense; AGGCGCGTACCCTCGATATTTGGGC
>probe:Drosophila_2:1627181_at:43:21; Interrogation_Position=591; Antisense; ATATTTGGGCCTTCCGTGCCATGGA
>probe:Drosophila_2:1627181_at:578:505; Interrogation_Position=606; Antisense; GTGCCATGGAGCTCAATCTTCGCCA
>probe:Drosophila_2:1627181_at:636:527; Interrogation_Position=632; Antisense; GGGACGCAGAACAGTCAGGGCCAAT
>probe:Drosophila_2:1627181_at:570:265; Interrogation_Position=643; Antisense; CAGTCAGGGCCAATTACTCGTTATT
>probe:Drosophila_2:1627181_at:464:245; Interrogation_Position=654; Antisense; AATTACTCGTTATTGCAGGCATTAG
>probe:Drosophila_2:1627181_at:439:11; Interrogation_Position=674; Antisense; ATTAGAAGCCATTGCGGTCCTGCAT
>probe:Drosophila_2:1627181_at:68:537; Interrogation_Position=689; Antisense; GGTCCTGCATCTCCAAATATTGGCC
>probe:Drosophila_2:1627181_at:614:577; Interrogation_Position=710; Antisense; GGCCACAGTTGGTCTTTTGATACAT
>probe:Drosophila_2:1627181_at:389:667; Interrogation_Position=730; Antisense; TACATCGTTCTTGTGTTTTTCGCTG
>probe:Drosophila_2:1627181_at:518:697; Interrogation_Position=745; Antisense; TTTTTCGCTGGCTGTCCTTCCAAAG

Paste this into a BLAST search page for me
AAGTAAGCATAAGCATCCTCCACCTGCATCCTCCACCTCAAAGAAGAGTGCATCGTGTGTGTTAGCAGGCGCGTAAGGCGCGTACCCTCGATATTTGGGCATATTTGGGCCTTCCGTGCCATGGAGTGCCATGGAGCTCAATCTTCGCCAGGGACGCAGAACAGTCAGGGCCAATCAGTCAGGGCCAATTACTCGTTATTAATTACTCGTTATTGCAGGCATTAGATTAGAAGCCATTGCGGTCCTGCATGGTCCTGCATCTCCAAATATTGGCCGGCCACAGTTGGTCTTTTGATACATTACATCGTTCTTGTGTTTTTCGCTGTTTTTCGCTGGCTGTCCTTCCAAAG

Full Affymetrix probeset data:

Annotations for 1627181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720