FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627182_at:

>probe:Drosophila_2:1627182_at:653:427; Interrogation_Position=127; Antisense; GAGATCAGCGGCGAATGGTTCAAGA
>probe:Drosophila_2:1627182_at:119:591; Interrogation_Position=142; Antisense; TGGTTCAAGAAACCCATCCTCAGGT
>probe:Drosophila_2:1627182_at:535:647; Interrogation_Position=161; Antisense; TCAGGTTCGATCGTCTTTTTGCCAC
>probe:Drosophila_2:1627182_at:100:701; Interrogation_Position=176; Antisense; TTTTTGCCACCGAAGAATCACCGTC
>probe:Drosophila_2:1627182_at:329:609; Interrogation_Position=218; Antisense; TGAGAAGGCCCAGCAGAAGCGACAA
>probe:Drosophila_2:1627182_at:334:81; Interrogation_Position=242; Antisense; AGGGTGAAACCACGGAGAGCTCCAA
>probe:Drosophila_2:1627182_at:394:59; Interrogation_Position=280; Antisense; ATGATCACCTCCATGCTCGGATTCG
>probe:Drosophila_2:1627182_at:554:281; Interrogation_Position=295; Antisense; CTCGGATTCGTGAGCAGTGTCATCA
>probe:Drosophila_2:1627182_at:277:65; Interrogation_Position=31; Antisense; ATGGTTTTGCTCTTCCTTATCGGAT
>probe:Drosophila_2:1627182_at:14:517; Interrogation_Position=311; Antisense; GTGTCATCAACTTTGGCAGGACCTT
>probe:Drosophila_2:1627182_at:52:277; Interrogation_Position=46; Antisense; CTTATCGGATGTCTCGTCATGCAGA
>probe:Drosophila_2:1627182_at:660:637; Interrogation_Position=59; Antisense; TCGTCATGCAGACAATCAACGCCCT
>probe:Drosophila_2:1627182_at:632:651; Interrogation_Position=74; Antisense; TCAACGCCCTGCCATTCGATAGATT
>probe:Drosophila_2:1627182_at:472:315; Interrogation_Position=84; Antisense; GCCATTCGATAGATTCAGCCAGGAG

Paste this into a BLAST search page for me
GAGATCAGCGGCGAATGGTTCAAGATGGTTCAAGAAACCCATCCTCAGGTTCAGGTTCGATCGTCTTTTTGCCACTTTTTGCCACCGAAGAATCACCGTCTGAGAAGGCCCAGCAGAAGCGACAAAGGGTGAAACCACGGAGAGCTCCAAATGATCACCTCCATGCTCGGATTCGCTCGGATTCGTGAGCAGTGTCATCAATGGTTTTGCTCTTCCTTATCGGATGTGTCATCAACTTTGGCAGGACCTTCTTATCGGATGTCTCGTCATGCAGATCGTCATGCAGACAATCAACGCCCTTCAACGCCCTGCCATTCGATAGATTGCCATTCGATAGATTCAGCCAGGAG

Full Affymetrix probeset data:

Annotations for 1627182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720