FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627183_at:

>probe:Drosophila_2:1627183_at:717:365; Interrogation_Position=507; Antisense; GAATAAGTACATCCGCAGGCTGAAG
>probe:Drosophila_2:1627183_at:547:309; Interrogation_Position=536; Antisense; CCAAGCCGGAGCTGGGATACTCGAT
>probe:Drosophila_2:1627183_at:588:231; Interrogation_Position=568; Antisense; AATGAGCAATTGTCGCACATACCGC
>probe:Drosophila_2:1627183_at:80:523; Interrogation_Position=622; Antisense; GTGGCCATCTGGTGCACCAATTCGA
>probe:Drosophila_2:1627183_at:132:409; Interrogation_Position=645; Antisense; GACGCTGCATCAGTTGGCCCTGGAG
>probe:Drosophila_2:1627183_at:599:723; Interrogation_Position=687; Antisense; TTGGAATCTCCGGTTGCTCCACAAG
>probe:Drosophila_2:1627183_at:53:323; Interrogation_Position=702; Antisense; GCTCCACAAGCTCCGATGGTACAAA
>probe:Drosophila_2:1627183_at:517:153; Interrogation_Position=733; Antisense; ACAGACCATGAACTAATTGCTCCCC
>probe:Drosophila_2:1627183_at:468:137; Interrogation_Position=788; Antisense; ACGAGATGCTCTACGTGGCCTGTCG
>probe:Drosophila_2:1627183_at:419:501; Interrogation_Position=809; Antisense; GTCGCTCCGATGCTTCTGAAAACTA
>probe:Drosophila_2:1627183_at:467:627; Interrogation_Position=845; Antisense; TCCAACAGACCGAGCTGATCTTCAG
>probe:Drosophila_2:1627183_at:728:127; Interrogation_Position=900; Antisense; ACCACTGCTGTCTTGGCTGAGGGAG
>probe:Drosophila_2:1627183_at:636:607; Interrogation_Position=917; Antisense; TGAGGGAGCACCTCCTGTTGGATAA
>probe:Drosophila_2:1627183_at:101:179; Interrogation_Position=957; Antisense; AAACTGCCTGGAGCTGTTTGCCCGA

Paste this into a BLAST search page for me
GAATAAGTACATCCGCAGGCTGAAGCCAAGCCGGAGCTGGGATACTCGATAATGAGCAATTGTCGCACATACCGCGTGGCCATCTGGTGCACCAATTCGAGACGCTGCATCAGTTGGCCCTGGAGTTGGAATCTCCGGTTGCTCCACAAGGCTCCACAAGCTCCGATGGTACAAAACAGACCATGAACTAATTGCTCCCCACGAGATGCTCTACGTGGCCTGTCGGTCGCTCCGATGCTTCTGAAAACTATCCAACAGACCGAGCTGATCTTCAGACCACTGCTGTCTTGGCTGAGGGAGTGAGGGAGCACCTCCTGTTGGATAAAAACTGCCTGGAGCTGTTTGCCCGA

Full Affymetrix probeset data:

Annotations for 1627183_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720