FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627184_at:

>probe:Drosophila_2:1627184_at:1:635; Interrogation_Position=1094; Antisense; TCGCGATCCATGGAGCGCTCTTTAA
>probe:Drosophila_2:1627184_at:360:201; Interrogation_Position=1160; Antisense; AACCGCAAGGGTCGCAATCGATCTC
>probe:Drosophila_2:1627184_at:641:317; Interrogation_Position=1233; Antisense; GCCGTGGTGATCGTGGCAATTCCAA
>probe:Drosophila_2:1627184_at:263:585; Interrogation_Position=1246; Antisense; TGGCAATTCCAATAGCCGAGACAAT
>probe:Drosophila_2:1627184_at:518:357; Interrogation_Position=1272; Antisense; GCAACAGCACCAACCTAAGACGAGT
>probe:Drosophila_2:1627184_at:301:83; Interrogation_Position=1294; Antisense; AGTGGACCGCGACAGATCTCTAACA
>probe:Drosophila_2:1627184_at:695:657; Interrogation_Position=1314; Antisense; TAACACCTCCGAGCTTTCTGGGAAG
>probe:Drosophila_2:1627184_at:384:209; Interrogation_Position=1336; Antisense; AAGCACATTTGCCAAGCCAGCGGAT
>probe:Drosophila_2:1627184_at:134:205; Interrogation_Position=1349; Antisense; AAGCCAGCGGATTTCATCGAGGAAT
>probe:Drosophila_2:1627184_at:373:251; Interrogation_Position=1378; Antisense; CAAGGGCCACCAAATGCTCATGAAA
>probe:Drosophila_2:1627184_at:565:355; Interrogation_Position=1416; Antisense; GCACGGGAACTGGACTGGGCTCAAA
>probe:Drosophila_2:1627184_at:701:517; Interrogation_Position=1508; Antisense; GTGGGCGCTAATATGCACGATCCCT
>probe:Drosophila_2:1627184_at:26:137; Interrogation_Position=1524; Antisense; ACGATCCCTTCGAGAGCTTTCGGAA
>probe:Drosophila_2:1627184_at:175:687; Interrogation_Position=1600; Antisense; TTAGGATCTGCCAACGGTCATAACT

Paste this into a BLAST search page for me
TCGCGATCCATGGAGCGCTCTTTAAAACCGCAAGGGTCGCAATCGATCTCGCCGTGGTGATCGTGGCAATTCCAATGGCAATTCCAATAGCCGAGACAATGCAACAGCACCAACCTAAGACGAGTAGTGGACCGCGACAGATCTCTAACATAACACCTCCGAGCTTTCTGGGAAGAAGCACATTTGCCAAGCCAGCGGATAAGCCAGCGGATTTCATCGAGGAATCAAGGGCCACCAAATGCTCATGAAAGCACGGGAACTGGACTGGGCTCAAAGTGGGCGCTAATATGCACGATCCCTACGATCCCTTCGAGAGCTTTCGGAATTAGGATCTGCCAACGGTCATAACT

Full Affymetrix probeset data:

Annotations for 1627184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720