FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627186_at:

>probe:Drosophila_2:1627186_at:153:367; Interrogation_Position=576; Antisense; GAATCAGAGATCCATCCACTTGCGC
>probe:Drosophila_2:1627186_at:612:557; Interrogation_Position=625; Antisense; GGAAACGATCTGTGGCAGCCCTACG
>probe:Drosophila_2:1627186_at:19:569; Interrogation_Position=638; Antisense; GGCAGCCCTACGGAGTCCAAGAGTG
>probe:Drosophila_2:1627186_at:628:505; Interrogation_Position=652; Antisense; GTCCAAGAGTGCCTTCAACTCCAGA
>probe:Drosophila_2:1627186_at:55:625; Interrogation_Position=680; Antisense; TGCGCACCACCTACGAAAGGATCTT
>probe:Drosophila_2:1627186_at:526:543; Interrogation_Position=698; Antisense; GGATCTTCGAGTGCTACGAAACATT
>probe:Drosophila_2:1627186_at:283:389; Interrogation_Position=715; Antisense; GAAACATTCAGCGACTGCTATGGAT
>probe:Drosophila_2:1627186_at:367:369; Interrogation_Position=743; Antisense; GAATGCTGGGACTCCATTTGCTGAC
>probe:Drosophila_2:1627186_at:93:611; Interrogation_Position=764; Antisense; TGACCAGCTTTCAGTTCGTGACCAA
>probe:Drosophila_2:1627186_at:157:469; Interrogation_Position=777; Antisense; GTTCGTGACCAATGCCTACTGGATG
>probe:Drosophila_2:1627186_at:370:35; Interrogation_Position=802; Antisense; ATCATGGGCATTTACGATGGCGGCA
>probe:Drosophila_2:1627186_at:657:361; Interrogation_Position=824; Antisense; GCAATGTCCGTTCACTGATCTTCAA
>probe:Drosophila_2:1627186_at:620:257; Interrogation_Position=836; Antisense; CACTGATCTTCAACGGAGCCACGGG
>probe:Drosophila_2:1627186_at:3:145; Interrogation_Position=886; Antisense; ACTCTTTTTTGGCACGGCGATTCAG

Paste this into a BLAST search page for me
GAATCAGAGATCCATCCACTTGCGCGGAAACGATCTGTGGCAGCCCTACGGGCAGCCCTACGGAGTCCAAGAGTGGTCCAAGAGTGCCTTCAACTCCAGATGCGCACCACCTACGAAAGGATCTTGGATCTTCGAGTGCTACGAAACATTGAAACATTCAGCGACTGCTATGGATGAATGCTGGGACTCCATTTGCTGACTGACCAGCTTTCAGTTCGTGACCAAGTTCGTGACCAATGCCTACTGGATGATCATGGGCATTTACGATGGCGGCAGCAATGTCCGTTCACTGATCTTCAACACTGATCTTCAACGGAGCCACGGGACTCTTTTTTGGCACGGCGATTCAG

Full Affymetrix probeset data:

Annotations for 1627186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720