Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627188_at:

>probe:Drosophila_2:1627188_at:606:671; Interrogation_Position=1454; Antisense; TACCTAAGGGCTTGCATTTCCGAGA
>probe:Drosophila_2:1627188_at:462:19; Interrogation_Position=1469; Antisense; ATTTCCGAGACGATGCGCATACGCA
>probe:Drosophila_2:1627188_at:599:27; Interrogation_Position=1487; Antisense; ATACGCAGCGTTGTCCCACTGGGCA
>probe:Drosophila_2:1627188_at:214:595; Interrogation_Position=1506; Antisense; TGGGCATTCCGCACGGATGCAAAGA
>probe:Drosophila_2:1627188_at:254:421; Interrogation_Position=1529; Antisense; GAGAACTTCGTCGTGGGCGATTATT
>probe:Drosophila_2:1627188_at:468:57; Interrogation_Position=1571; Antisense; ATGATCGTTTGCTCGGAGTGGGCTA
>probe:Drosophila_2:1627188_at:609:433; Interrogation_Position=1586; Antisense; GAGTGGGCTATCCACATGGACCCAG
>probe:Drosophila_2:1627188_at:432:417; Interrogation_Position=1643; Antisense; GAGCGCTTCTTGACCGCCGATGGAG
>probe:Drosophila_2:1627188_at:113:13; Interrogation_Position=1696; Antisense; ATTCTCGTCCGGCTATCGAATGTGT
>probe:Drosophila_2:1627188_at:394:63; Interrogation_Position=1715; Antisense; ATGTGTCCCGGCGAAGAGATGGCTC
>probe:Drosophila_2:1627188_at:258:427; Interrogation_Position=1730; Antisense; GAGATGGCTCGCATGATACTCACGC
>probe:Drosophila_2:1627188_at:510:23; Interrogation_Position=1745; Antisense; ATACTCACGCTCTTTACGGGTCGCA
>probe:Drosophila_2:1627188_at:355:355; Interrogation_Position=1855; Antisense; GCACATGCTGCGATTCACCAAGCTG
>probe:Drosophila_2:1627188_at:620:541; Interrogation_Position=1930; Antisense; GGTTGTGCATCCTGAGTGCATCTTA

Paste this into a BLAST search page for me
TACCTAAGGGCTTGCATTTCCGAGAATTTCCGAGACGATGCGCATACGCAATACGCAGCGTTGTCCCACTGGGCATGGGCATTCCGCACGGATGCAAAGAGAGAACTTCGTCGTGGGCGATTATTATGATCGTTTGCTCGGAGTGGGCTAGAGTGGGCTATCCACATGGACCCAGGAGCGCTTCTTGACCGCCGATGGAGATTCTCGTCCGGCTATCGAATGTGTATGTGTCCCGGCGAAGAGATGGCTCGAGATGGCTCGCATGATACTCACGCATACTCACGCTCTTTACGGGTCGCAGCACATGCTGCGATTCACCAAGCTGGGTTGTGCATCCTGAGTGCATCTTA

Full Affymetrix probeset data:

Annotations for 1627188_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime