FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627190_at:

>probe:Drosophila_2:1627190_at:21:605; Interrogation_Position=14; Antisense; TGTTGTGGCAAACTGTCTACCTGCT
>probe:Drosophila_2:1627190_at:284:67; Interrogation_Position=150; Antisense; AGGCGGTATCGTGGGCGGCGGCATC
>probe:Drosophila_2:1627190_at:191:341; Interrogation_Position=217; Antisense; GCTATCCAAACAGTTCCCGTTGTGT
>probe:Drosophila_2:1627190_at:299:187; Interrogation_Position=225; Antisense; AACAGTTCCCGTTGTGTCCACTGTG
>probe:Drosophila_2:1627190_at:266:35; Interrogation_Position=256; Antisense; ATCACCACTGTTCCCGTCATACAGA
>probe:Drosophila_2:1627190_at:193:599; Interrogation_Position=27; Antisense; TGTCTACCTGCTCGTCTTGGCGTGC
>probe:Drosophila_2:1627190_at:223:293; Interrogation_Position=270; Antisense; CGTCATACAGACGATACCCAGCTAT
>probe:Drosophila_2:1627190_at:361:403; Interrogation_Position=279; Antisense; GACGATACCCAGCTATGGCTACGGA
>probe:Drosophila_2:1627190_at:401:309; Interrogation_Position=287; Antisense; CCAGCTATGGCTACGGATATGGCGG
>probe:Drosophila_2:1627190_at:521:331; Interrogation_Position=374; Antisense; GCGGCGCTGTGGGTTTTGCCAAATT
>probe:Drosophila_2:1627190_at:317:713; Interrogation_Position=389; Antisense; TTGCCAAATTCAAAGGCGGTTTCTT
>probe:Drosophila_2:1627190_at:421:727; Interrogation_Position=43; Antisense; TTGGCGTGCGCCGTGGTCAGCACCA
>probe:Drosophila_2:1627190_at:486:629; Interrogation_Position=79; Antisense; TCCAGCGTCGACGAGGAGAACATTA
>probe:Drosophila_2:1627190_at:450:423; Interrogation_Position=94; Antisense; GAGAACATTAGAAGACCCCGTCACA

Paste this into a BLAST search page for me
TGTTGTGGCAAACTGTCTACCTGCTAGGCGGTATCGTGGGCGGCGGCATCGCTATCCAAACAGTTCCCGTTGTGTAACAGTTCCCGTTGTGTCCACTGTGATCACCACTGTTCCCGTCATACAGATGTCTACCTGCTCGTCTTGGCGTGCCGTCATACAGACGATACCCAGCTATGACGATACCCAGCTATGGCTACGGACCAGCTATGGCTACGGATATGGCGGGCGGCGCTGTGGGTTTTGCCAAATTTTGCCAAATTCAAAGGCGGTTTCTTTTGGCGTGCGCCGTGGTCAGCACCATCCAGCGTCGACGAGGAGAACATTAGAGAACATTAGAAGACCCCGTCACA

Full Affymetrix probeset data:

Annotations for 1627190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720