FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627194_at:

>probe:Drosophila_2:1627194_at:135:637; Interrogation_Position=511; Antisense; TCGAGGACTACAGGACATGCTTGAT
>probe:Drosophila_2:1627194_at:162:445; Interrogation_Position=533; Antisense; GATGATGGCACTGCTTCATCAACTC
>probe:Drosophila_2:1627194_at:440:647; Interrogation_Position=548; Antisense; TCATCAACTCGTCACATCTACAATT
>probe:Drosophila_2:1627194_at:222:247; Interrogation_Position=569; Antisense; AATTCCGCCGATGAAAGTAGCAACG
>probe:Drosophila_2:1627194_at:646:67; Interrogation_Position=594; Antisense; ATGGCAGCAGCTATAACGATTACAA
>probe:Drosophila_2:1627194_at:536:677; Interrogation_Position=622; Antisense; TAGTTTGGACAGTTCGCAACAGTTC
>probe:Drosophila_2:1627194_at:295:355; Interrogation_Position=637; Antisense; GCAACAGTTCTTGACGGGAGCCACC
>probe:Drosophila_2:1627194_at:453:293; Interrogation_Position=721; Antisense; CGAGATTTCCGGAGGTGGCTATATC
>probe:Drosophila_2:1627194_at:172:211; Interrogation_Position=759; Antisense; AAGAGCAGGACCTCAAATTCGACTC
>probe:Drosophila_2:1627194_at:165:247; Interrogation_Position=774; Antisense; AATTCGACTCCTTTGATAGCTTCAG
>probe:Drosophila_2:1627194_at:552:673; Interrogation_Position=790; Antisense; TAGCTTCAGTGACGAGCAGCCAGAT
>probe:Drosophila_2:1627194_at:564:437; Interrogation_Position=818; Antisense; GAGGAGCTACTCGATTATATTTCAT
>probe:Drosophila_2:1627194_at:406:239; Interrogation_Position=908; Antisense; AATACCCTAAATTGTTGCCTTAGTG
>probe:Drosophila_2:1627194_at:420:13; Interrogation_Position=960; Antisense; ATTAGCCTCTAAGTTACCCCATATT

Paste this into a BLAST search page for me
TCGAGGACTACAGGACATGCTTGATGATGATGGCACTGCTTCATCAACTCTCATCAACTCGTCACATCTACAATTAATTCCGCCGATGAAAGTAGCAACGATGGCAGCAGCTATAACGATTACAATAGTTTGGACAGTTCGCAACAGTTCGCAACAGTTCTTGACGGGAGCCACCCGAGATTTCCGGAGGTGGCTATATCAAGAGCAGGACCTCAAATTCGACTCAATTCGACTCCTTTGATAGCTTCAGTAGCTTCAGTGACGAGCAGCCAGATGAGGAGCTACTCGATTATATTTCATAATACCCTAAATTGTTGCCTTAGTGATTAGCCTCTAAGTTACCCCATATT

Full Affymetrix probeset data:

Annotations for 1627194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720