FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627195_at:

>probe:Drosophila_2:1627195_at:227:193; Interrogation_Position=1095; Antisense; AACTACTGCTGCAACGACTGCAGCT
>probe:Drosophila_2:1627195_at:71:407; Interrogation_Position=1110; Antisense; GACTGCAGCTCCTTCTGTAAGTAGA
>probe:Drosophila_2:1627195_at:258:337; Interrogation_Position=1117; Antisense; GCTCCTTCTGTAAGTAGAATTCCAA
>probe:Drosophila_2:1627195_at:641:363; Interrogation_Position=1133; Antisense; GAATTCCAAGCAATACTGAAATCTG
>probe:Drosophila_2:1627195_at:642:281; Interrogation_Position=576; Antisense; CTCGTCCTATCCAGTTTATGCCAAA
>probe:Drosophila_2:1627195_at:160:263; Interrogation_Position=587; Antisense; CAGTTTATGCCAAACCAGTGCCGGC
>probe:Drosophila_2:1627195_at:149:577; Interrogation_Position=609; Antisense; GGCCTATGCCGCTGTTTATAGTTAC
>probe:Drosophila_2:1627195_at:100:705; Interrogation_Position=624; Antisense; TTATAGTTACGCTGACACCACCAAG
>probe:Drosophila_2:1627195_at:156:227; Interrogation_Position=646; Antisense; AAGGCGCCATCTACCGGATCGACTA
>probe:Drosophila_2:1627195_at:359:271; Interrogation_Position=653; Antisense; CATCTACCGGATCGACTACGGCGTC
>probe:Drosophila_2:1627195_at:315:313; Interrogation_Position=679; Antisense; GCCACTACAGGCACCACAAAATCAA
>probe:Drosophila_2:1627195_at:257:179; Interrogation_Position=702; Antisense; AAACAGATATCCTGGATACCCCACC
>probe:Drosophila_2:1627195_at:676:541; Interrogation_Position=715; Antisense; GGATACCCCACCAAATACGCGACAA
>probe:Drosophila_2:1627195_at:196:127; Interrogation_Position=724; Antisense; ACCAAATACGCGACAACCACAGCGG

Paste this into a BLAST search page for me
AACTACTGCTGCAACGACTGCAGCTGACTGCAGCTCCTTCTGTAAGTAGAGCTCCTTCTGTAAGTAGAATTCCAAGAATTCCAAGCAATACTGAAATCTGCTCGTCCTATCCAGTTTATGCCAAACAGTTTATGCCAAACCAGTGCCGGCGGCCTATGCCGCTGTTTATAGTTACTTATAGTTACGCTGACACCACCAAGAAGGCGCCATCTACCGGATCGACTACATCTACCGGATCGACTACGGCGTCGCCACTACAGGCACCACAAAATCAAAAACAGATATCCTGGATACCCCACCGGATACCCCACCAAATACGCGACAAACCAAATACGCGACAACCACAGCGG

Full Affymetrix probeset data:

Annotations for 1627195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720