FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627196_at:

>probe:Drosophila_2:1627196_at:295:515; Interrogation_Position=103; Antisense; GTGTTACTTCGAGTGCGGCATCAAG
>probe:Drosophila_2:1627196_at:24:509; Interrogation_Position=115; Antisense; GTGCGGCATCAAGAACGTAAATCAT
>probe:Drosophila_2:1627196_at:567:369; Interrogation_Position=127; Antisense; GAACGTAAATCATAGCTTTCAGGAT
>probe:Drosophila_2:1627196_at:117:51; Interrogation_Position=13; Antisense; ATGCCCTCCATTGTCACATTTATAT
>probe:Drosophila_2:1627196_at:7:601; Interrogation_Position=155; Antisense; TGTAAATTTTCGGTTTCTCTTCATA
>probe:Drosophila_2:1627196_at:291:479; Interrogation_Position=167; Antisense; GTTTCTCTTCATACACGAATGCGCA
>probe:Drosophila_2:1627196_at:361:369; Interrogation_Position=183; Antisense; GAATGCGCAACATTTGATGCGGGAA
>probe:Drosophila_2:1627196_at:590:697; Interrogation_Position=32; Antisense; TTATATTATTTCTTTGGTCTGGCCT
>probe:Drosophila_2:1627196_at:421:703; Interrogation_Position=37; Antisense; TTATTTCTTTGGTCTGGCCTTTGTT
>probe:Drosophila_2:1627196_at:558:277; Interrogation_Position=55; Antisense; CTTTGTTGGCTGGTGCGATGTTTTC
>probe:Drosophila_2:1627196_at:483:573; Interrogation_Position=62; Antisense; GGCTGGTGCGATGTTTTCGACGATA
>probe:Drosophila_2:1627196_at:459:443; Interrogation_Position=71; Antisense; GATGTTTTCGACGATATCGACCTAT
>probe:Drosophila_2:1627196_at:74:41; Interrogation_Position=86; Antisense; ATCGACCTATCGGACTTGTGTTACT
>probe:Drosophila_2:1627196_at:649:41; Interrogation_Position=94; Antisense; ATCGGACTTGTGTTACTTCGAGTGC

Paste this into a BLAST search page for me
GTGTTACTTCGAGTGCGGCATCAAGGTGCGGCATCAAGAACGTAAATCATGAACGTAAATCATAGCTTTCAGGATATGCCCTCCATTGTCACATTTATATTGTAAATTTTCGGTTTCTCTTCATAGTTTCTCTTCATACACGAATGCGCAGAATGCGCAACATTTGATGCGGGAATTATATTATTTCTTTGGTCTGGCCTTTATTTCTTTGGTCTGGCCTTTGTTCTTTGTTGGCTGGTGCGATGTTTTCGGCTGGTGCGATGTTTTCGACGATAGATGTTTTCGACGATATCGACCTATATCGACCTATCGGACTTGTGTTACTATCGGACTTGTGTTACTTCGAGTGC

Full Affymetrix probeset data:

Annotations for 1627196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720