FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627197_at:

>probe:Drosophila_2:1627197_at:172:107; Interrogation_Position=1830; Antisense; AGAAAGCACCTACCAGATGTCCCGC
>probe:Drosophila_2:1627197_at:188:559; Interrogation_Position=1856; Antisense; GGACACCGGTGATCAAGGACATCAT
>probe:Drosophila_2:1627197_at:653:677; Interrogation_Position=1892; Antisense; TAGAGGATAAGCTCGATCTCCGCCA
>probe:Drosophila_2:1627197_at:75:525; Interrogation_Position=1932; Antisense; GGGCAGGGCCCAAAATACCAATTAT
>probe:Drosophila_2:1627197_at:22:341; Interrogation_Position=1976; Antisense; GCTACGGTCACTGGCACAAGGACAA
>probe:Drosophila_2:1627197_at:584:71; Interrogation_Position=2012; Antisense; AGGTAAAGAACGTGCCCAGGCTTAT
>probe:Drosophila_2:1627197_at:212:269; Interrogation_Position=2028; Antisense; CAGGCTTATTGTCTTCATCGTGGGC
>probe:Drosophila_2:1627197_at:338:483; Interrogation_Position=2060; Antisense; GTATGTCCGAGATGCGGTGCGCCTA
>probe:Drosophila_2:1627197_at:496:533; Interrogation_Position=2075; Antisense; GGTGCGCCTACGAGGTGACCAATGC
>probe:Drosophila_2:1627197_at:360:49; Interrogation_Position=2096; Antisense; ATGCGGTTCGCAATTGGGAGGTCCT
>probe:Drosophila_2:1627197_at:525:525; Interrogation_Position=2111; Antisense; GGGAGGTCCTTGTTGGCTCTTCGCA
>probe:Drosophila_2:1627197_at:513:395; Interrogation_Position=2149; Antisense; GAAATCTTCCTCAGCGATTTGGGCA
>probe:Drosophila_2:1627197_at:396:327; Interrogation_Position=2162; Antisense; GCGATTTGGGCAGTCTCTCGAAGGA
>probe:Drosophila_2:1627197_at:457:229; Interrogation_Position=2220; Antisense; AATGGTTTTGTCACATTTGTCGTGT

Paste this into a BLAST search page for me
AGAAAGCACCTACCAGATGTCCCGCGGACACCGGTGATCAAGGACATCATTAGAGGATAAGCTCGATCTCCGCCAGGGCAGGGCCCAAAATACCAATTATGCTACGGTCACTGGCACAAGGACAAAGGTAAAGAACGTGCCCAGGCTTATCAGGCTTATTGTCTTCATCGTGGGCGTATGTCCGAGATGCGGTGCGCCTAGGTGCGCCTACGAGGTGACCAATGCATGCGGTTCGCAATTGGGAGGTCCTGGGAGGTCCTTGTTGGCTCTTCGCAGAAATCTTCCTCAGCGATTTGGGCAGCGATTTGGGCAGTCTCTCGAAGGAAATGGTTTTGTCACATTTGTCGTGT

Full Affymetrix probeset data:

Annotations for 1627197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720