FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627198_at:

>probe:Drosophila_2:1627198_at:683:363; Interrogation_Position=15; Antisense; GAATTTCCAGTGCATCACGATAGCA
>probe:Drosophila_2:1627198_at:228:571; Interrogation_Position=162; Antisense; GGCTACGAATCGCACTTACAAATAC
>probe:Drosophila_2:1627198_at:105:277; Interrogation_Position=187; Antisense; CTATCGGTCAAGGTTCGGCTTTATA
>probe:Drosophila_2:1627198_at:575:667; Interrogation_Position=221; Antisense; TACATCATTTTACGGTGAATCTGGG
>probe:Drosophila_2:1627198_at:615:325; Interrogation_Position=255; Antisense; GCGATCAAATGGTCTAATGCCCTTT
>probe:Drosophila_2:1627198_at:191:163; Interrogation_Position=285; Antisense; AAATTTTACCTTTGATGGCTGCAAG
>probe:Drosophila_2:1627198_at:633:535; Interrogation_Position=312; Antisense; GGTCGCAAATGTCGGAAATCCCATG
>probe:Drosophila_2:1627198_at:300:47; Interrogation_Position=334; Antisense; ATGGTTTTATTTCTCTTTGCCTTAT
>probe:Drosophila_2:1627198_at:452:663; Interrogation_Position=360; Antisense; TAAACCCTACTCAAACATCAACCAT
>probe:Drosophila_2:1627198_at:504:253; Interrogation_Position=378; Antisense; CAACCATTCTTGTCCCTATACATTT
>probe:Drosophila_2:1627198_at:143:667; Interrogation_Position=402; Antisense; TACTAAATACGTACCGCTTCCCGAG
>probe:Drosophila_2:1627198_at:499:275; Interrogation_Position=418; Antisense; CTTCCCGAGGGCGATTATGTATTCA
>probe:Drosophila_2:1627198_at:638:635; Interrogation_Position=471; Antisense; TCGAGCCATTGTTAGAGTCCACTTC
>probe:Drosophila_2:1627198_at:599:667; Interrogation_Position=483; Antisense; TAGAGTCCACTTCTCGTTTACGTAA

Paste this into a BLAST search page for me
GAATTTCCAGTGCATCACGATAGCAGGCTACGAATCGCACTTACAAATACCTATCGGTCAAGGTTCGGCTTTATATACATCATTTTACGGTGAATCTGGGGCGATCAAATGGTCTAATGCCCTTTAAATTTTACCTTTGATGGCTGCAAGGGTCGCAAATGTCGGAAATCCCATGATGGTTTTATTTCTCTTTGCCTTATTAAACCCTACTCAAACATCAACCATCAACCATTCTTGTCCCTATACATTTTACTAAATACGTACCGCTTCCCGAGCTTCCCGAGGGCGATTATGTATTCATCGAGCCATTGTTAGAGTCCACTTCTAGAGTCCACTTCTCGTTTACGTAA

Full Affymetrix probeset data:

Annotations for 1627198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720