Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627202_at:

>probe:Drosophila_2:1627202_at:478:389; Interrogation_Position=171; Antisense; GAAAAACTCGCCTGGCCAAGTGGTA
>probe:Drosophila_2:1627202_at:669:155; Interrogation_Position=273; Antisense; ACACCAACTTTGTGGAGTTCCGCAA
>probe:Drosophila_2:1627202_at:126:471; Interrogation_Position=289; Antisense; GTTCCGCAACTTCAAGATCGTCTAC
>probe:Drosophila_2:1627202_at:692:409; Interrogation_Position=315; Antisense; GACGCTATGCGGGTCTGTACTTCTG
>probe:Drosophila_2:1627202_at:643:667; Interrogation_Position=332; Antisense; TACTTCTGCATCTGCGTGGACGTAA
>probe:Drosophila_2:1627202_at:100:133; Interrogation_Position=357; Antisense; ACGACAACAACCTGTGCTATCTGGA
>probe:Drosophila_2:1627202_at:499:585; Interrogation_Position=378; Antisense; TGGAGGCCATTCACAACTTCGTGGA
>probe:Drosophila_2:1627202_at:437:435; Interrogation_Position=401; Antisense; GAGGTGCTCAACGAATACTTCCATA
>probe:Drosophila_2:1627202_at:403:287; Interrogation_Position=437; Antisense; CTGGATCTGGTCTTCAACTTCTACA
>probe:Drosophila_2:1627202_at:171:99; Interrogation_Position=501; Antisense; AGATCCGGGAGACCTCGCAGACGAA
>probe:Drosophila_2:1627202_at:384:119; Interrogation_Position=537; Antisense; AGCTGCTCACGCTAAATTCGCTGGA
>probe:Drosophila_2:1627202_at:704:549; Interrogation_Position=559; Antisense; GGAGTAGCGGCCCAATTCATACATA
>probe:Drosophila_2:1627202_at:233:681; Interrogation_Position=582; Antisense; TATGTATATCGGATCTGCCAGATGC
>probe:Drosophila_2:1627202_at:254:303; Interrogation_Position=626; Antisense; CCGCCTATCGAATCTTCTTTCATAT

Paste this into a BLAST search page for me
GAAAAACTCGCCTGGCCAAGTGGTAACACCAACTTTGTGGAGTTCCGCAAGTTCCGCAACTTCAAGATCGTCTACGACGCTATGCGGGTCTGTACTTCTGTACTTCTGCATCTGCGTGGACGTAAACGACAACAACCTGTGCTATCTGGATGGAGGCCATTCACAACTTCGTGGAGAGGTGCTCAACGAATACTTCCATACTGGATCTGGTCTTCAACTTCTACAAGATCCGGGAGACCTCGCAGACGAAAGCTGCTCACGCTAAATTCGCTGGAGGAGTAGCGGCCCAATTCATACATATATGTATATCGGATCTGCCAGATGCCCGCCTATCGAATCTTCTTTCATAT

Full Affymetrix probeset data:

Annotations for 1627202_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime