FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627203_at:

>probe:Drosophila_2:1627203_at:228:645; Interrogation_Position=2620; Antisense; TCATCGATCCGCAGGGTAAGTTGTT
>probe:Drosophila_2:1627203_at:196:637; Interrogation_Position=2623; Antisense; TCGATCCGCAGGGTAAGTTGTTCCA
>probe:Drosophila_2:1627203_at:490:449; Interrogation_Position=2625; Antisense; GATCCGCAGGGTAAGTTGTTCCAGG
>probe:Drosophila_2:1627203_at:503:323; Interrogation_Position=2630; Antisense; GCAGGGTAAGTTGTTCCAGGGTTAT
>probe:Drosophila_2:1627203_at:129:491; Interrogation_Position=2635; Antisense; GTAAGTTGTTCCAGGGTTATCAATC
>probe:Drosophila_2:1627203_at:596:467; Interrogation_Position=2639; Antisense; GTTGTTCCAGGGTTATCAATCATTC
>probe:Drosophila_2:1627203_at:471:629; Interrogation_Position=2644; Antisense; TCCAGGGTTATCAATCATTCGGGTA
>probe:Drosophila_2:1627203_at:326:531; Interrogation_Position=2648; Antisense; GGGTTATCAATCATTCGGGTATCAT
>probe:Drosophila_2:1627203_at:524:249; Interrogation_Position=2655; Antisense; CAATCATTCGGGTATCATGTTTCTT
>probe:Drosophila_2:1627203_at:503:9; Interrogation_Position=2660; Antisense; ATTCGGGTATCATGTTTCTTATTCC
>probe:Drosophila_2:1627203_at:344:289; Interrogation_Position=2663; Antisense; CGGGTATCATGTTTCTTATTCCTGG
>probe:Drosophila_2:1627203_at:488:697; Interrogation_Position=2674; Antisense; TTTCTTATTCCTGGCAGTGCAAGCC
>probe:Drosophila_2:1627203_at:602:703; Interrogation_Position=2678; Antisense; TTATTCCTGGCAGTGCAAGCCAACA
>probe:Drosophila_2:1627203_at:461:9; Interrogation_Position=2680; Antisense; ATTCCTGGCAGTGCAAGCCAACAAA

Paste this into a BLAST search page for me
TCATCGATCCGCAGGGTAAGTTGTTTCGATCCGCAGGGTAAGTTGTTCCAGATCCGCAGGGTAAGTTGTTCCAGGGCAGGGTAAGTTGTTCCAGGGTTATGTAAGTTGTTCCAGGGTTATCAATCGTTGTTCCAGGGTTATCAATCATTCTCCAGGGTTATCAATCATTCGGGTAGGGTTATCAATCATTCGGGTATCATCAATCATTCGGGTATCATGTTTCTTATTCGGGTATCATGTTTCTTATTCCCGGGTATCATGTTTCTTATTCCTGGTTTCTTATTCCTGGCAGTGCAAGCCTTATTCCTGGCAGTGCAAGCCAACAATTCCTGGCAGTGCAAGCCAACAAA

Full Affymetrix probeset data:

Annotations for 1627203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720