Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627204_at:

>probe:Drosophila_2:1627204_at:282:511; Interrogation_Position=1108; Antisense; GTGACGCCCGCAATCTGGACCAGTA
>probe:Drosophila_2:1627204_at:386:161; Interrogation_Position=1144; Antisense; ACAAGATCCTGGTCGACGTGCCCTG
>probe:Drosophila_2:1627204_at:449:249; Interrogation_Position=1205; Antisense; CAATATTTTCAAGCCGACGCGCATA
>probe:Drosophila_2:1627204_at:482:661; Interrogation_Position=1228; Antisense; TAAAGGAGCGCCTGCGGATACCAGA
>probe:Drosophila_2:1627204_at:72:267; Interrogation_Position=1297; Antisense; CAGGCGGCAGTTTGGTCTACTCCAC
>probe:Drosophila_2:1627204_at:84:383; Interrogation_Position=1343; Antisense; GAACGATGGTGTCGTCCACATGGCT
>probe:Drosophila_2:1627204_at:420:153; Interrogation_Position=1360; Antisense; ACATGGCTCTGCAAAAGGTCTTCAC
>probe:Drosophila_2:1627204_at:668:79; Interrogation_Position=1375; Antisense; AGGTCTTCACGGAGTACGGCATCAC
>probe:Drosophila_2:1627204_at:479:141; Interrogation_Position=1390; Antisense; ACGGCATCACAACTACCATCAAGGA
>probe:Drosophila_2:1627204_at:442:653; Interrogation_Position=1408; Antisense; TCAAGGATCTGAGTCGCCACACGGC
>probe:Drosophila_2:1627204_at:132:443; Interrogation_Position=1443; Antisense; GATGTCTTCAAGTTCGAGCACCCAA
>probe:Drosophila_2:1627204_at:541:585; Interrogation_Position=1481; Antisense; TGGACAAATGGTGGTGCCCTACCTG
>probe:Drosophila_2:1627204_at:611:309; Interrogation_Position=1509; Antisense; GCCAACTTTGGACCCATGTACTTTA
>probe:Drosophila_2:1627204_at:334:211; Interrogation_Position=1584; Antisense; AAGACTATATAACTGTTGCCCCAAT

Paste this into a BLAST search page for me
GTGACGCCCGCAATCTGGACCAGTAACAAGATCCTGGTCGACGTGCCCTGCAATATTTTCAAGCCGACGCGCATATAAAGGAGCGCCTGCGGATACCAGACAGGCGGCAGTTTGGTCTACTCCACGAACGATGGTGTCGTCCACATGGCTACATGGCTCTGCAAAAGGTCTTCACAGGTCTTCACGGAGTACGGCATCACACGGCATCACAACTACCATCAAGGATCAAGGATCTGAGTCGCCACACGGCGATGTCTTCAAGTTCGAGCACCCAATGGACAAATGGTGGTGCCCTACCTGGCCAACTTTGGACCCATGTACTTTAAAGACTATATAACTGTTGCCCCAAT

Full Affymetrix probeset data:

Annotations for 1627204_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime