FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627207_at:

>probe:Drosophila_2:1627207_at:499:485; Interrogation_Position=461; Antisense; GTAGTACCTATTTCGAATCGGAATT
>probe:Drosophila_2:1627207_at:202:389; Interrogation_Position=491; Antisense; GAAAAAGCCTCAGAAGCGCCTCTAC
>probe:Drosophila_2:1627207_at:651:669; Interrogation_Position=513; Antisense; TACCGAAGTCAAGCTCGTGCCGAAT
>probe:Drosophila_2:1627207_at:573:505; Interrogation_Position=529; Antisense; GTGCCGAATAACTCAAGCTACTCAG
>probe:Drosophila_2:1627207_at:543:725; Interrogation_Position=554; Antisense; TTGACAGACCAAACTACTCAGCTCT
>probe:Drosophila_2:1627207_at:306:375; Interrogation_Position=589; Antisense; GAAGAGTCAGTCGATGTGAGCTCAG
>probe:Drosophila_2:1627207_at:165:545; Interrogation_Position=618; Antisense; GGATGCCACGAATACCCTGAAGGAT
>probe:Drosophila_2:1627207_at:170:171; Interrogation_Position=646; Antisense; AAAGTCGTTCTGATCAGGCTGCAAC
>probe:Drosophila_2:1627207_at:190:71; Interrogation_Position=661; Antisense; AGGCTGCAACAGGAGTACTATCGAT
>probe:Drosophila_2:1627207_at:584:683; Interrogation_Position=679; Antisense; TATCGATGCGAAAACGCCCGGGCAG
>probe:Drosophila_2:1627207_at:72:51; Interrogation_Position=775; Antisense; ATGCGCCTGAAAAACGAACTTCTCG
>probe:Drosophila_2:1627207_at:649:255; Interrogation_Position=825; Antisense; CAAAGTCGCGCAAAGCAAGGCTTCA
>probe:Drosophila_2:1627207_at:500:497; Interrogation_Position=890; Antisense; GTCTTCATAATGTCAGTGCTCTTCA
>probe:Drosophila_2:1627207_at:189:391; Interrogation_Position=955; Antisense; GAAACTCATGTACACTCCTTGATTT

Paste this into a BLAST search page for me
GTAGTACCTATTTCGAATCGGAATTGAAAAAGCCTCAGAAGCGCCTCTACTACCGAAGTCAAGCTCGTGCCGAATGTGCCGAATAACTCAAGCTACTCAGTTGACAGACCAAACTACTCAGCTCTGAAGAGTCAGTCGATGTGAGCTCAGGGATGCCACGAATACCCTGAAGGATAAAGTCGTTCTGATCAGGCTGCAACAGGCTGCAACAGGAGTACTATCGATTATCGATGCGAAAACGCCCGGGCAGATGCGCCTGAAAAACGAACTTCTCGCAAAGTCGCGCAAAGCAAGGCTTCAGTCTTCATAATGTCAGTGCTCTTCAGAAACTCATGTACACTCCTTGATTT

Full Affymetrix probeset data:

Annotations for 1627207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720