FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627208_at:

>probe:Drosophila_2:1627208_at:424:669; Interrogation_Position=1010; Antisense; TATCCGATTCGGTACCTTAAAGGCA
>probe:Drosophila_2:1627208_at:673:387; Interrogation_Position=1037; Antisense; GAAAATATGGCATTCCTCATCCCAA
>probe:Drosophila_2:1627208_at:167:137; Interrogation_Position=1078; Antisense; ACGATGTCTGTGTAAAGCGCGCTTG
>probe:Drosophila_2:1627208_at:246:175; Interrogation_Position=1091; Antisense; AAAGCGCGCTTGTTCTGTAAAGTAA
>probe:Drosophila_2:1627208_at:33:339; Interrogation_Position=606; Antisense; GCTCTGGAGAGGATGCTTGCCGACA
>probe:Drosophila_2:1627208_at:703:615; Interrogation_Position=650; Antisense; TGAATATGGTGCAGCTTGCCTCCTA
>probe:Drosophila_2:1627208_at:71:345; Interrogation_Position=663; Antisense; GCTTGCCTCCTATTCACTGATGAAG
>probe:Drosophila_2:1627208_at:519:369; Interrogation_Position=712; Antisense; GAAGGAATACCTCTTCACCTGACCG
>probe:Drosophila_2:1627208_at:313:55; Interrogation_Position=878; Antisense; ATGAAGGCGCCTTTGCCGTGTGGAA
>probe:Drosophila_2:1627208_at:32:373; Interrogation_Position=900; Antisense; GAAGGGTTTCACTCCGTATCTAATG
>probe:Drosophila_2:1627208_at:203:483; Interrogation_Position=915; Antisense; GTATCTAATGCGTATGGGTCCACAC
>probe:Drosophila_2:1627208_at:656:531; Interrogation_Position=930; Antisense; GGGTCCACACACGATATTTTCATTT
>probe:Drosophila_2:1627208_at:118:689; Interrogation_Position=944; Antisense; TATTTTCATTTGTCTTCTTGGAGCA
>probe:Drosophila_2:1627208_at:113:681; Interrogation_Position=993; Antisense; TATGCTCAGTGATTCGCTATCCGAT

Paste this into a BLAST search page for me
TATCCGATTCGGTACCTTAAAGGCAGAAAATATGGCATTCCTCATCCCAAACGATGTCTGTGTAAAGCGCGCTTGAAAGCGCGCTTGTTCTGTAAAGTAAGCTCTGGAGAGGATGCTTGCCGACATGAATATGGTGCAGCTTGCCTCCTAGCTTGCCTCCTATTCACTGATGAAGGAAGGAATACCTCTTCACCTGACCGATGAAGGCGCCTTTGCCGTGTGGAAGAAGGGTTTCACTCCGTATCTAATGGTATCTAATGCGTATGGGTCCACACGGGTCCACACACGATATTTTCATTTTATTTTCATTTGTCTTCTTGGAGCATATGCTCAGTGATTCGCTATCCGAT

Full Affymetrix probeset data:

Annotations for 1627208_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720