Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627209_at:

>probe:Drosophila_2:1627209_at:274:357; Interrogation_Position=1713; Antisense; GCACATGCTCCGATGTCTTCAAATG
>probe:Drosophila_2:1627209_at:687:379; Interrogation_Position=1738; Antisense; GAAGCCACATGAGCTCAACTCGGTG
>probe:Drosophila_2:1627209_at:108:521; Interrogation_Position=1760; Antisense; GTGGACTTTCGGCTGAAGATCATAA
>probe:Drosophila_2:1627209_at:707:179; Interrogation_Position=1811; Antisense; AAAAAGGTGGGCTTCCTCTATGTCG
>probe:Drosophila_2:1627209_at:611:157; Interrogation_Position=1840; Antisense; ACACGATGCACCCTATGGACGGATG
>probe:Drosophila_2:1627209_at:58:189; Interrogation_Position=1898; Antisense; AACAGAATCGTTGAGTGCACCATGA
>probe:Drosophila_2:1627209_at:590:195; Interrogation_Position=1934; Antisense; AACTGGGACTTTATGCGCGAGCGAA
>probe:Drosophila_2:1627209_at:454:189; Interrogation_Position=1976; Antisense; AACAGTTATAATACAGCCCGCTCCG
>probe:Drosophila_2:1627209_at:32:301; Interrogation_Position=1992; Antisense; CCCGCTCCGTTGTGGACAGCATAAA
>probe:Drosophila_2:1627209_at:247:263; Interrogation_Position=2008; Antisense; CAGCATAAAGCATCCAGTCACCAAG
>probe:Drosophila_2:1627209_at:320:179; Interrogation_Position=2044; Antisense; AAACTTTATCGCAAGCTCTGGCTAT
>probe:Drosophila_2:1627209_at:611:207; Interrogation_Position=2056; Antisense; AAGCTCTGGCTATCGGAATGATCAT
>probe:Drosophila_2:1627209_at:554:29; Interrogation_Position=2127; Antisense; ATAACCACTTTTATCCCCATGGTCA
>probe:Drosophila_2:1627209_at:677:281; Interrogation_Position=2173; Antisense; CTGCGTGAACCCGACATTAGGAAAT

Paste this into a BLAST search page for me
GCACATGCTCCGATGTCTTCAAATGGAAGCCACATGAGCTCAACTCGGTGGTGGACTTTCGGCTGAAGATCATAAAAAAAGGTGGGCTTCCTCTATGTCGACACGATGCACCCTATGGACGGATGAACAGAATCGTTGAGTGCACCATGAAACTGGGACTTTATGCGCGAGCGAAAACAGTTATAATACAGCCCGCTCCGCCCGCTCCGTTGTGGACAGCATAAACAGCATAAAGCATCCAGTCACCAAGAAACTTTATCGCAAGCTCTGGCTATAAGCTCTGGCTATCGGAATGATCATATAACCACTTTTATCCCCATGGTCACTGCGTGAACCCGACATTAGGAAAT

Full Affymetrix probeset data:

Annotations for 1627209_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime