FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627210_at:

>probe:Drosophila_2:1627210_at:214:517; Interrogation_Position=1780; Antisense; GTGTCCATCTGACCTCTTTTATTAT
>probe:Drosophila_2:1627210_at:380:703; Interrogation_Position=1798; Antisense; TTATTATTTGGCACTCGCGATCTCC
>probe:Drosophila_2:1627210_at:173:679; Interrogation_Position=1824; Antisense; TAGTGGCCACGATCATTGCCTTAAA
>probe:Drosophila_2:1627210_at:696:535; Interrogation_Position=1873; Antisense; GGTCCTGGTCTGGTTCTATGAGCAC
>probe:Drosophila_2:1627210_at:394:355; Interrogation_Position=1894; Antisense; GCACGGTGTGTGTCTCAGTCTGTCA
>probe:Drosophila_2:1627210_at:391:267; Interrogation_Position=1909; Antisense; CAGTCTGTCAGCCAAGCGGGAACTT
>probe:Drosophila_2:1627210_at:498:179; Interrogation_Position=1943; Antisense; AAAAGGTTCGATGCCTTTCTGGCGT
>probe:Drosophila_2:1627210_at:218:707; Interrogation_Position=1968; Antisense; TTACCCATAAGGACGAGGCTCTGCT
>probe:Drosophila_2:1627210_at:11:525; Interrogation_Position=2068; Antisense; GGGCGAATCTATTCCCGATTGCATT
>probe:Drosophila_2:1627210_at:428:37; Interrogation_Position=2098; Antisense; ATCTATAAAGGACTCGCGGCGCATT
>probe:Drosophila_2:1627210_at:22:333; Interrogation_Position=2113; Antisense; GCGGCGCATTATTGTCCTCATGACA
>probe:Drosophila_2:1627210_at:715:325; Interrogation_Position=2202; Antisense; GCGATCGGTGCAAGCGTCTGATAGT
>probe:Drosophila_2:1627210_at:667:83; Interrogation_Position=2224; Antisense; AGTGGTGCTCTATCCAAACGTGAAG
>probe:Drosophila_2:1627210_at:180:207; Interrogation_Position=2333; Antisense; AAGCTGATTTACTCGATGCCGCTAC

Paste this into a BLAST search page for me
GTGTCCATCTGACCTCTTTTATTATTTATTATTTGGCACTCGCGATCTCCTAGTGGCCACGATCATTGCCTTAAAGGTCCTGGTCTGGTTCTATGAGCACGCACGGTGTGTGTCTCAGTCTGTCACAGTCTGTCAGCCAAGCGGGAACTTAAAAGGTTCGATGCCTTTCTGGCGTTTACCCATAAGGACGAGGCTCTGCTGGGCGAATCTATTCCCGATTGCATTATCTATAAAGGACTCGCGGCGCATTGCGGCGCATTATTGTCCTCATGACAGCGATCGGTGCAAGCGTCTGATAGTAGTGGTGCTCTATCCAAACGTGAAGAAGCTGATTTACTCGATGCCGCTAC

Full Affymetrix probeset data:

Annotations for 1627210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720