FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627211_at:

>probe:Drosophila_2:1627211_at:386:417; Interrogation_Position=362; Antisense; GAGCTGCAGGCCAAAAGGTATTTCA
>probe:Drosophila_2:1627211_at:630:179; Interrogation_Position=392; Antisense; AAAAAGGCGCTGCATCCCAAATCTG
>probe:Drosophila_2:1627211_at:682:627; Interrogation_Position=418; Antisense; TGCCAAAGTGCAGGACCCAGTTGTT
>probe:Drosophila_2:1627211_at:573:113; Interrogation_Position=462; Antisense; AGCAGGACGATTCGAATCCCTTCGA
>probe:Drosophila_2:1627211_at:106:453; Interrogation_Position=485; Antisense; GATCTCCTGCAGGACCACAATGAAA
>probe:Drosophila_2:1627211_at:464:263; Interrogation_Position=521; Antisense; CAGCTCAGTATCCTGCAGTTGCAGT
>probe:Drosophila_2:1627211_at:529:83; Interrogation_Position=543; Antisense; AGTGTCTGGAAATGCGCGAACTTCT
>probe:Drosophila_2:1627211_at:494:325; Interrogation_Position=558; Antisense; GCGAACTTCTGCACGAGCTGGATAT
>probe:Drosophila_2:1627211_at:334:189; Interrogation_Position=623; Antisense; AACCGGGTAGCAATGGCCAAGTCCT
>probe:Drosophila_2:1627211_at:237:581; Interrogation_Position=636; Antisense; TGGCCAAGTCCTCCGAAGAATCAAT
>probe:Drosophila_2:1627211_at:723:673; Interrogation_Position=791; Antisense; TACCTGACCGAGAACCACGTGAACG
>probe:Drosophila_2:1627211_at:110:247; Interrogation_Position=827; Antisense; CAGAACGCTTCTTTGTTCGGTCGGG
>probe:Drosophila_2:1627211_at:96:373; Interrogation_Position=879; Antisense; GAAGGTTCATCTCCGGACCAAAGAA
>probe:Drosophila_2:1627211_at:286:473; Interrogation_Position=913; Antisense; GTTAACGGGCATGCGGTGCCACAAC

Paste this into a BLAST search page for me
GAGCTGCAGGCCAAAAGGTATTTCAAAAAAGGCGCTGCATCCCAAATCTGTGCCAAAGTGCAGGACCCAGTTGTTAGCAGGACGATTCGAATCCCTTCGAGATCTCCTGCAGGACCACAATGAAACAGCTCAGTATCCTGCAGTTGCAGTAGTGTCTGGAAATGCGCGAACTTCTGCGAACTTCTGCACGAGCTGGATATAACCGGGTAGCAATGGCCAAGTCCTTGGCCAAGTCCTCCGAAGAATCAATTACCTGACCGAGAACCACGTGAACGCAGAACGCTTCTTTGTTCGGTCGGGGAAGGTTCATCTCCGGACCAAAGAAGTTAACGGGCATGCGGTGCCACAAC

Full Affymetrix probeset data:

Annotations for 1627211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720