FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627212_at:

>probe:Drosophila_2:1627212_at:543:511; Interrogation_Position=1837; Antisense; GTGATTTTGGTCAGCTGGGCGAACT
>probe:Drosophila_2:1627212_at:69:595; Interrogation_Position=1852; Antisense; TGGGCGAACTATTGCGTCAGCACAT
>probe:Drosophila_2:1627212_at:86:157; Interrogation_Position=1912; Antisense; ACACCCAGACTGCTCAAGTTGATAC
>probe:Drosophila_2:1627212_at:195:457; Interrogation_Position=1932; Antisense; GATACGGTGAGTACATCGACCTCGA
>probe:Drosophila_2:1627212_at:339:41; Interrogation_Position=1961; Antisense; ATCGGTGACCACCAATAGCGTCGGC
>probe:Drosophila_2:1627212_at:37:303; Interrogation_Position=2022; Antisense; CCCGTCTACCACACTGATGAAAGCA
>probe:Drosophila_2:1627212_at:128:165; Interrogation_Position=2052; Antisense; AAATCGATCCATGCCATGATGGCCA
>probe:Drosophila_2:1627212_at:664:269; Interrogation_Position=2066; Antisense; CATGATGGCCATGGGTTTCAGCAAC
>probe:Drosophila_2:1627212_at:172:697; Interrogation_Position=2081; Antisense; TTTCAGCAACGAGGGCGCCTGGCTA
>probe:Drosophila_2:1627212_at:412:263; Interrogation_Position=2109; Antisense; CAGCTCCTAGAGTCGGTTCAGGGCA
>probe:Drosophila_2:1627212_at:551:241; Interrogation_Position=2133; Antisense; AATATCTCAGCTGCCTTGGACGTAA
>probe:Drosophila_2:1627212_at:338:383; Interrogation_Position=2159; Antisense; GAACGTATCGCAGAACCGCAACTAA
>probe:Drosophila_2:1627212_at:611:115; Interrogation_Position=2282; Antisense; AGCTTAGTTTTTCTGTGGTGCTAGA
>probe:Drosophila_2:1627212_at:308:535; Interrogation_Position=2298; Antisense; GGTGCTAGATTTATCTCGTAGCCAA

Paste this into a BLAST search page for me
GTGATTTTGGTCAGCTGGGCGAACTTGGGCGAACTATTGCGTCAGCACATACACCCAGACTGCTCAAGTTGATACGATACGGTGAGTACATCGACCTCGAATCGGTGACCACCAATAGCGTCGGCCCCGTCTACCACACTGATGAAAGCAAAATCGATCCATGCCATGATGGCCACATGATGGCCATGGGTTTCAGCAACTTTCAGCAACGAGGGCGCCTGGCTACAGCTCCTAGAGTCGGTTCAGGGCAAATATCTCAGCTGCCTTGGACGTAAGAACGTATCGCAGAACCGCAACTAAAGCTTAGTTTTTCTGTGGTGCTAGAGGTGCTAGATTTATCTCGTAGCCAA

Full Affymetrix probeset data:

Annotations for 1627212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720