Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627214_s_at:

>probe:Drosophila_2:1627214_s_at:365:637; Interrogation_Position=220; Antisense; TCTGACCATCGACACAAATCCGGAT
>probe:Drosophila_2:1627214_s_at:17:533; Interrogation_Position=257; Antisense; GGTGGATTCCGGCAGCAAAGCTCAA
>probe:Drosophila_2:1627214_s_at:648:203; Interrogation_Position=274; Antisense; AAGCTCAACGAACACGGGTCCCAAG
>probe:Drosophila_2:1627214_s_at:26:77; Interrogation_Position=377; Antisense; AGGAGAACAAGCACACCACCATCAT
>probe:Drosophila_2:1627214_s_at:227:597; Interrogation_Position=433; Antisense; TGTGCCACGCTGAACAAATGCCTTG
>probe:Drosophila_2:1627214_s_at:293:167; Interrogation_Position=448; Antisense; AAATGCCTTGACAGTCTGGCCAGCG
>probe:Drosophila_2:1627214_s_at:134:459; Interrogation_Position=472; Antisense; GATTATCCGTCCATTAAGTTCGCCA
>probe:Drosophila_2:1627214_s_at:243:217; Interrogation_Position=487; Antisense; AAGTTCGCCAAGATCTGCAGTTCCG
>probe:Drosophila_2:1627214_s_at:642:369; Interrogation_Position=518; Antisense; GAATGAGCAGGGACTTCCGCACCAA
>probe:Drosophila_2:1627214_s_at:704:719; Interrogation_Position=547; Antisense; TTGCCCGCCCTACTGGTATACAAGG
>probe:Drosophila_2:1627214_s_at:696:663; Interrogation_Position=565; Antisense; TACAAGGCCCAAGCGGTCATCGGAA
>probe:Drosophila_2:1627214_s_at:229:271; Interrogation_Position=582; Antisense; CATCGGAAACTTTGTGCGGCTTACC
>probe:Drosophila_2:1627214_s_at:501:705; Interrogation_Position=602; Antisense; TTACCGATGACCTCAGCGATGACTT
>probe:Drosophila_2:1627214_s_at:335:317; Interrogation_Position=631; Antisense; GCCTCCGACGTCGAGAGTTTTCTGA

Paste this into a BLAST search page for me
TCTGACCATCGACACAAATCCGGATGGTGGATTCCGGCAGCAAAGCTCAAAAGCTCAACGAACACGGGTCCCAAGAGGAGAACAAGCACACCACCATCATTGTGCCACGCTGAACAAATGCCTTGAAATGCCTTGACAGTCTGGCCAGCGGATTATCCGTCCATTAAGTTCGCCAAAGTTCGCCAAGATCTGCAGTTCCGGAATGAGCAGGGACTTCCGCACCAATTGCCCGCCCTACTGGTATACAAGGTACAAGGCCCAAGCGGTCATCGGAACATCGGAAACTTTGTGCGGCTTACCTTACCGATGACCTCAGCGATGACTTGCCTCCGACGTCGAGAGTTTTCTGA

Full Affymetrix probeset data:

Annotations for 1627214_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime