FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627217_at:

>probe:Drosophila_2:1627217_at:416:563; Interrogation_Position=1127; Antisense; GGAATCGTTTTCGTGTCCATCTATC
>probe:Drosophila_2:1627217_at:411:505; Interrogation_Position=1141; Antisense; GTCCATCTATCTGGGATTGCACTTT
>probe:Drosophila_2:1627217_at:230:65; Interrogation_Position=1181; Antisense; ATGGGCTTGACCGTCATGTCCTGGA
>probe:Drosophila_2:1627217_at:308:9; Interrogation_Position=1205; Antisense; ATTGCCCTCTTCTGCATAGCTATTT
>probe:Drosophila_2:1627217_at:451:117; Interrogation_Position=1222; Antisense; AGCTATTTTTGTGGGCTGCTACACC
>probe:Drosophila_2:1627217_at:341:337; Interrogation_Position=1261; Antisense; GCTCACCTGGGTGCTTAATGCGGAG
>probe:Drosophila_2:1627217_at:107:227; Interrogation_Position=1277; Antisense; AATGCGGAGCTTCTTGTGAGGCCCA
>probe:Drosophila_2:1627217_at:649:269; Interrogation_Position=1300; Antisense; CATGCGACCATTGGGCTGCTCTATT
>probe:Drosophila_2:1627217_at:487:619; Interrogation_Position=1316; Antisense; TGCTCTATTGTCTGTGCCTTTAACT
>probe:Drosophila_2:1627217_at:130:335; Interrogation_Position=1450; Antisense; GCTGATCTACATTCCGGAGACCAAG
>probe:Drosophila_2:1627217_at:189:711; Interrogation_Position=1518; Antisense; TTAACCGGCCAGCAGTGATCACATT
>probe:Drosophila_2:1627217_at:528:605; Interrogation_Position=1533; Antisense; TGATCACATTCACATCCAGCAGCGA
>probe:Drosophila_2:1627217_at:25:297; Interrogation_Position=1555; Antisense; CGACTCCTCGAACGCTTAGTGTTTG
>probe:Drosophila_2:1627217_at:339:705; Interrogation_Position=1649; Antisense; TTATGAACTGTGTAGCCCCATGAGG

Paste this into a BLAST search page for me
GGAATCGTTTTCGTGTCCATCTATCGTCCATCTATCTGGGATTGCACTTTATGGGCTTGACCGTCATGTCCTGGAATTGCCCTCTTCTGCATAGCTATTTAGCTATTTTTGTGGGCTGCTACACCGCTCACCTGGGTGCTTAATGCGGAGAATGCGGAGCTTCTTGTGAGGCCCACATGCGACCATTGGGCTGCTCTATTTGCTCTATTGTCTGTGCCTTTAACTGCTGATCTACATTCCGGAGACCAAGTTAACCGGCCAGCAGTGATCACATTTGATCACATTCACATCCAGCAGCGACGACTCCTCGAACGCTTAGTGTTTGTTATGAACTGTGTAGCCCCATGAGG

Full Affymetrix probeset data:

Annotations for 1627217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720