FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627219_at:

>probe:Drosophila_2:1627219_at:226:539; Interrogation_Position=335; Antisense; GGCAAGGGCCGTTATGTAATCGTAA
>probe:Drosophila_2:1627219_at:679:59; Interrogation_Position=379; Antisense; AGGCCTAAAAACTCTGTTAACTCTG
>probe:Drosophila_2:1627219_at:648:473; Interrogation_Position=394; Antisense; GTTAACTCTGCTAACCGTTTCTTAG
>probe:Drosophila_2:1627219_at:131:179; Interrogation_Position=433; Antisense; AAACTATCTCTCTATTTCTCTTCTC
>probe:Drosophila_2:1627219_at:537:17; Interrogation_Position=446; Antisense; ATTTCTCTTCTCCTTAGCTAGCTTA
>probe:Drosophila_2:1627219_at:11:665; Interrogation_Position=502; Antisense; TAAATTTACGCTTTGCGCTGGCAGC
>probe:Drosophila_2:1627219_at:572:583; Interrogation_Position=520; Antisense; TGGCAGCGCCGCCTTAACAAGTTCT
>probe:Drosophila_2:1627219_at:130:663; Interrogation_Position=534; Antisense; TAACAAGTTCTCCAAGCTCTCATTG
>probe:Drosophila_2:1627219_at:8:7; Interrogation_Position=555; Antisense; ATTGCCAACCACCAAGTACCAAGTA
>probe:Drosophila_2:1627219_at:497:631; Interrogation_Position=603; Antisense; TCCTGGCATCCAACGTTTCGTGTAT
>probe:Drosophila_2:1627219_at:553:479; Interrogation_Position=617; Antisense; GTTTCGTGTATATAGCTTAGCCACA
>probe:Drosophila_2:1627219_at:114:707; Interrogation_Position=633; Antisense; TTAGCCACACAACTCCCAAAAGAAC
>probe:Drosophila_2:1627219_at:275:165; Interrogation_Position=729; Antisense; AAATCTCGACTTGCGATTGCCCGAA
>probe:Drosophila_2:1627219_at:66:423; Interrogation_Position=767; Antisense; GAGAATCTGTCAAAGCGTCGCTGCT

Paste this into a BLAST search page for me
GGCAAGGGCCGTTATGTAATCGTAAAGGCCTAAAAACTCTGTTAACTCTGGTTAACTCTGCTAACCGTTTCTTAGAAACTATCTCTCTATTTCTCTTCTCATTTCTCTTCTCCTTAGCTAGCTTATAAATTTACGCTTTGCGCTGGCAGCTGGCAGCGCCGCCTTAACAAGTTCTTAACAAGTTCTCCAAGCTCTCATTGATTGCCAACCACCAAGTACCAAGTATCCTGGCATCCAACGTTTCGTGTATGTTTCGTGTATATAGCTTAGCCACATTAGCCACACAACTCCCAAAAGAACAAATCTCGACTTGCGATTGCCCGAAGAGAATCTGTCAAAGCGTCGCTGCT

Full Affymetrix probeset data:

Annotations for 1627219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720