Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627220_at:

>probe:Drosophila_2:1627220_at:482:419; Interrogation_Position=233; Antisense; GAGCATGGAGTTTGCCGACATCACG
>probe:Drosophila_2:1627220_at:292:619; Interrogation_Position=266; Antisense; TGCATCCACCATGTTCTTCGGTGAA
>probe:Drosophila_2:1627220_at:135:383; Interrogation_Position=288; Antisense; GAACTCTTACGTGGATTTGCCGTCA
>probe:Drosophila_2:1627220_at:415:203; Interrogation_Position=330; Antisense; AAGGAACCGGCCACTATCAACTATC
>probe:Drosophila_2:1627220_at:699:385; Interrogation_Position=360; Antisense; GAAAAGGGACCACTGAGCCCGCGAT
>probe:Drosophila_2:1627220_at:500:551; Interrogation_Position=390; Antisense; GGAGAACATGCCCTTCGTCGTTATC
>probe:Drosophila_2:1627220_at:305:427; Interrogation_Position=421; Antisense; GAGAGGAGCGCTGCATCGCTTGCAA
>probe:Drosophila_2:1627220_at:254:487; Interrogation_Position=517; Antisense; GTACCACACGCTACGATATCGACAT
>probe:Drosophila_2:1627220_at:169:221; Interrogation_Position=546; Antisense; AAGTGCATCTACTGCGGATTCTGTC
>probe:Drosophila_2:1627220_at:425:109; Interrogation_Position=658; Antisense; AGAAGCTTCTCTGCAACGGCGACAA
>probe:Drosophila_2:1627220_at:331:221; Interrogation_Position=681; Antisense; AAGTGGGAGTCCGAGATTGCCTCTA
>probe:Drosophila_2:1627220_at:359:69; Interrogation_Position=712; Antisense; AGGCCGACCATCTCTATCGTTAAAG
>probe:Drosophila_2:1627220_at:58:663; Interrogation_Position=732; Antisense; TAAAGTTGCTTGTACCCCTAGAATT
>probe:Drosophila_2:1627220_at:321:663; Interrogation_Position=781; Antisense; TAAAGATCGTTGCTGTGGCTTCGTC

Paste this into a BLAST search page for me
GAGCATGGAGTTTGCCGACATCACGTGCATCCACCATGTTCTTCGGTGAAGAACTCTTACGTGGATTTGCCGTCAAAGGAACCGGCCACTATCAACTATCGAAAAGGGACCACTGAGCCCGCGATGGAGAACATGCCCTTCGTCGTTATCGAGAGGAGCGCTGCATCGCTTGCAAGTACCACACGCTACGATATCGACATAAGTGCATCTACTGCGGATTCTGTCAGAAGCTTCTCTGCAACGGCGACAAAAGTGGGAGTCCGAGATTGCCTCTAAGGCCGACCATCTCTATCGTTAAAGTAAAGTTGCTTGTACCCCTAGAATTTAAAGATCGTTGCTGTGGCTTCGTC

Full Affymetrix probeset data:

Annotations for 1627220_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime