FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627225_at:

>probe:Drosophila_2:1627225_at:28:719; Interrogation_Position=321; Antisense; TTCCTACTGGGCTTCATGGGCAGCG
>probe:Drosophila_2:1627225_at:155:489; Interrogation_Position=383; Antisense; GTACGCCATCTTCTTGAGTGTCTTG
>probe:Drosophila_2:1627225_at:81:723; Interrogation_Position=405; Antisense; TTGCTTATCGCAGAGATCGGCTTCT
>probe:Drosophila_2:1627225_at:94:291; Interrogation_Position=434; Antisense; CGTGGCCTTCGTGCTCAAGGACAAG
>probe:Drosophila_2:1627225_at:530:453; Interrogation_Position=464; Antisense; GATCAAAGACCAGGCCACCGAGGGA
>probe:Drosophila_2:1627225_at:171:261; Interrogation_Position=479; Antisense; CACCGAGGGACTCAAGGCCTTCATT
>probe:Drosophila_2:1627225_at:371:555; Interrogation_Position=518; Antisense; GGACGCAGACCAGCAGAATCTCATT
>probe:Drosophila_2:1627225_at:213:85; Interrogation_Position=568; Antisense; AGTGTTGCGGCATTGATGGTCCCAA
>probe:Drosophila_2:1627225_at:257:193; Interrogation_Position=609; Antisense; AACTACTTCAATTGCTCGTCTATCG
>probe:Drosophila_2:1627225_at:195:639; Interrogation_Position=624; Antisense; TCGTCTATCGCTATTGGCAGCAGGG
>probe:Drosophila_2:1627225_at:72:687; Interrogation_Position=758; Antisense; TATACATGAGCGTGGCTGCTTGCGC
>probe:Drosophila_2:1627225_at:9:71; Interrogation_Position=802; Antisense; AGGCCCATCTGATTAGTGTGGCGAT
>probe:Drosophila_2:1627225_at:349:621; Interrogation_Position=841; Antisense; TGCTCGTCCTGCAGGTGCAAAACAT
>probe:Drosophila_2:1627225_at:313:191; Interrogation_Position=861; Antisense; AACATTTCTATAGTCGTCGTTGTAT

Paste this into a BLAST search page for me
TTCCTACTGGGCTTCATGGGCAGCGGTACGCCATCTTCTTGAGTGTCTTGTTGCTTATCGCAGAGATCGGCTTCTCGTGGCCTTCGTGCTCAAGGACAAGGATCAAAGACCAGGCCACCGAGGGACACCGAGGGACTCAAGGCCTTCATTGGACGCAGACCAGCAGAATCTCATTAGTGTTGCGGCATTGATGGTCCCAAAACTACTTCAATTGCTCGTCTATCGTCGTCTATCGCTATTGGCAGCAGGGTATACATGAGCGTGGCTGCTTGCGCAGGCCCATCTGATTAGTGTGGCGATTGCTCGTCCTGCAGGTGCAAAACATAACATTTCTATAGTCGTCGTTGTAT

Full Affymetrix probeset data:

Annotations for 1627225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720