FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627226_at:

>probe:Drosophila_2:1627226_at:26:495; Interrogation_Position=171; Antisense; GTCCTTTAAAGTTGCCTACGAGTCG
>probe:Drosophila_2:1627226_at:681:19; Interrogation_Position=229; Antisense; ATTTGCGTCATGATCCTCGGTGTGC
>probe:Drosophila_2:1627226_at:535:621; Interrogation_Position=251; Antisense; TGCTGATCTATCTGTACCACTGCTG
>probe:Drosophila_2:1627226_at:383:533; Interrogation_Position=278; Antisense; GGTGCAGACTACTTGGAGCCCGAAC
>probe:Drosophila_2:1627226_at:728:485; Interrogation_Position=373; Antisense; GTCTTCGTCGTTTCCTGGGTAATCA
>probe:Drosophila_2:1627226_at:632:331; Interrogation_Position=416; Antisense; GCGGCATCATCTTTGTGGCTGAGAA
>probe:Drosophila_2:1627226_at:415:205; Interrogation_Position=456; Antisense; AAGCGGCAGGGCGATTTTTCTATTG
>probe:Drosophila_2:1627226_at:603:713; Interrogation_Position=473; Antisense; TTCTATTGGTCATCGGTCTGCTAAT
>probe:Drosophila_2:1627226_at:601:611; Interrogation_Position=497; Antisense; TGAAGCTTCTAGTTTTGGCCAATTT
>probe:Drosophila_2:1627226_at:270:687; Interrogation_Position=51; Antisense; TATAATGACGGTGCTCCGGTCGTAT
>probe:Drosophila_2:1627226_at:266:577; Interrogation_Position=513; Antisense; GGCCAATTTCTATTCGGTTTGCATA
>probe:Drosophila_2:1627226_at:195:723; Interrogation_Position=531; Antisense; TTGCATACGCATCTGGGCTTACTTA
>probe:Drosophila_2:1627226_at:122:583; Interrogation_Position=606; Antisense; TGGCGATCACCTCAATTTGTTCTTT
>probe:Drosophila_2:1627226_at:361:565; Interrogation_Position=97; Antisense; GGAATTTTGCAATTGGCTGCCATCA

Paste this into a BLAST search page for me
GTCCTTTAAAGTTGCCTACGAGTCGATTTGCGTCATGATCCTCGGTGTGCTGCTGATCTATCTGTACCACTGCTGGGTGCAGACTACTTGGAGCCCGAACGTCTTCGTCGTTTCCTGGGTAATCAGCGGCATCATCTTTGTGGCTGAGAAAAGCGGCAGGGCGATTTTTCTATTGTTCTATTGGTCATCGGTCTGCTAATTGAAGCTTCTAGTTTTGGCCAATTTTATAATGACGGTGCTCCGGTCGTATGGCCAATTTCTATTCGGTTTGCATATTGCATACGCATCTGGGCTTACTTATGGCGATCACCTCAATTTGTTCTTTGGAATTTTGCAATTGGCTGCCATCA

Full Affymetrix probeset data:

Annotations for 1627226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720