FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627227_at:

>probe:Drosophila_2:1627227_at:139:29; Interrogation_Position=1017; Antisense; ATACGGCACAAGTCAGAGCATTCTG
>probe:Drosophila_2:1627227_at:233:345; Interrogation_Position=1034; Antisense; GCATTCTGATTACGCTTCTGTTCAA
>probe:Drosophila_2:1627227_at:41:443; Interrogation_Position=1059; Antisense; GATGTAGCCAATCCCATTCGTTGTT
>probe:Drosophila_2:1627227_at:361:11; Interrogation_Position=1074; Antisense; ATTCGTTGTTGTTGTTCGCGTAGCA
>probe:Drosophila_2:1627227_at:300:329; Interrogation_Position=1091; Antisense; GCGTAGCAGTAATTGGTTCATCCCC
>probe:Drosophila_2:1627227_at:533:541; Interrogation_Position=1105; Antisense; GGTTCATCCCCACTACAGTTAATAA
>probe:Drosophila_2:1627227_at:306:439; Interrogation_Position=1165; Antisense; GAGGCTTCATTTATTGTCCGGCTCA
>probe:Drosophila_2:1627227_at:315:571; Interrogation_Position=1184; Antisense; GGCTCACTTCTTCTTATTCTTCTTG
>probe:Drosophila_2:1627227_at:69:247; Interrogation_Position=1221; Antisense; AATTCCAGGCCCAGGATGCACTTGG
>probe:Drosophila_2:1627227_at:406:479; Interrogation_Position=1260; Antisense; GTTTCCGTGAGCAGCGTGTGCACAA
>probe:Drosophila_2:1627227_at:697:163; Interrogation_Position=1283; Antisense; AAATCGCACCTGGTTGCCCTGGATT
>probe:Drosophila_2:1627227_at:499:119; Interrogation_Position=1311; Antisense; AGCTGCTCGTGCTTTTGGTGCGGCA
>probe:Drosophila_2:1627227_at:718:613; Interrogation_Position=1372; Antisense; TGCACAGCTTGATGAACTCGGCCAG
>probe:Drosophila_2:1627227_at:660:431; Interrogation_Position=1397; Antisense; GATGATGCCGTACGCCTCGATGTTG

Paste this into a BLAST search page for me
ATACGGCACAAGTCAGAGCATTCTGGCATTCTGATTACGCTTCTGTTCAAGATGTAGCCAATCCCATTCGTTGTTATTCGTTGTTGTTGTTCGCGTAGCAGCGTAGCAGTAATTGGTTCATCCCCGGTTCATCCCCACTACAGTTAATAAGAGGCTTCATTTATTGTCCGGCTCAGGCTCACTTCTTCTTATTCTTCTTGAATTCCAGGCCCAGGATGCACTTGGGTTTCCGTGAGCAGCGTGTGCACAAAAATCGCACCTGGTTGCCCTGGATTAGCTGCTCGTGCTTTTGGTGCGGCATGCACAGCTTGATGAACTCGGCCAGGATGATGCCGTACGCCTCGATGTTG

Full Affymetrix probeset data:

Annotations for 1627227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720