FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627228_at:

>probe:Drosophila_2:1627228_at:311:183; Interrogation_Position=1059; Antisense; AAAAGCAGCGAGTTCACCACACAAA
>probe:Drosophila_2:1627228_at:684:449; Interrogation_Position=1204; Antisense; GATCGAGTTTTAGGGTATCACACAA
>probe:Drosophila_2:1627228_at:22:87; Interrogation_Position=1248; Antisense; AGTGCATAACTCGTCGTATCTTATA
>probe:Drosophila_2:1627228_at:314:459; Interrogation_Position=1304; Antisense; GATATACCGCACATTCGATCGAAAA
>probe:Drosophila_2:1627228_at:354:701; Interrogation_Position=1359; Antisense; TTTTGGGAAGGATCTCTGCGCTGGC
>probe:Drosophila_2:1627228_at:35:625; Interrogation_Position=1375; Antisense; TGCGCTGGCCGCCATCTAGGATTTC
>probe:Drosophila_2:1627228_at:201:675; Interrogation_Position=1391; Antisense; TAGGATTTCCGCACTTTCATTTCGA
>probe:Drosophila_2:1627228_at:599:697; Interrogation_Position=1405; Antisense; TTTCATTTCGATTACCATTACCCAC
>probe:Drosophila_2:1627228_at:122:297; Interrogation_Position=1419; Antisense; CCATTACCCACTAATACCACTTTGT
>probe:Drosophila_2:1627228_at:284:409; Interrogation_Position=1446; Antisense; TCCTTTTACCATTTTGCGTTGCAAG
>probe:Drosophila_2:1627228_at:128:249; Interrogation_Position=1477; Antisense; CAATTGTGTGTACTTTCTGTGCAAA
>probe:Drosophila_2:1627228_at:33:295; Interrogation_Position=1509; Antisense; CGATGCCTTAATTCGATGATATCAA
>probe:Drosophila_2:1627228_at:143:183; Interrogation_Position=1538; Antisense; AAAACTGGCGAAAGCCACACGCAAA
>probe:Drosophila_2:1627228_at:56:189; Interrogation_Position=1562; Antisense; AACAGAACTTGCACTGCCAATCAAT

Paste this into a BLAST search page for me
AAAAGCAGCGAGTTCACCACACAAAGATCGAGTTTTAGGGTATCACACAAAGTGCATAACTCGTCGTATCTTATAGATATACCGCACATTCGATCGAAAATTTTGGGAAGGATCTCTGCGCTGGCTGCGCTGGCCGCCATCTAGGATTTCTAGGATTTCCGCACTTTCATTTCGATTTCATTTCGATTACCATTACCCACCCATTACCCACTAATACCACTTTGTTCCTTTTACCATTTTGCGTTGCAAGCAATTGTGTGTACTTTCTGTGCAAACGATGCCTTAATTCGATGATATCAAAAAACTGGCGAAAGCCACACGCAAAAACAGAACTTGCACTGCCAATCAAT

Full Affymetrix probeset data:

Annotations for 1627228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720