FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627235_at:

>probe:Drosophila_2:1627235_at:428:387; Interrogation_Position=1064; Antisense; GAAACTTTCCTACACTGCAAGAATG
>probe:Drosophila_2:1627235_at:422:611; Interrogation_Position=1123; Antisense; TGAAACTTTCCTACAGACACCTGCT
>probe:Drosophila_2:1627235_at:676:399; Interrogation_Position=1138; Antisense; GACACCTGCTGATTAGTCTTATCAC
>probe:Drosophila_2:1627235_at:314:649; Interrogation_Position=1159; Antisense; TCACGTACGACCTGATCAACTCAAG
>probe:Drosophila_2:1627235_at:685:203; Interrogation_Position=1181; Antisense; AAGCCTCAAGCCTGGTCGTGATCAC
>probe:Drosophila_2:1627235_at:87:35; Interrogation_Position=1201; Antisense; ATCACTCGCAGAAATCCCTTTTTTG
>probe:Drosophila_2:1627235_at:380:357; Interrogation_Position=1249; Antisense; GCACACACTATTAGCAACCGTCATA
>probe:Drosophila_2:1627235_at:531:453; Interrogation_Position=1281; Antisense; GATAAGAGACCAGCTACCCATTGTG
>probe:Drosophila_2:1627235_at:722:541; Interrogation_Position=1309; Antisense; GGATTTCAATTTTCAGACGGGCAAG
>probe:Drosophila_2:1627235_at:492:379; Interrogation_Position=803; Antisense; GAACCAAGTCTCGTACCGGAGCTGA
>probe:Drosophila_2:1627235_at:663:163; Interrogation_Position=827; Antisense; AAATATGAGCCAACCATCACTGCCG
>probe:Drosophila_2:1627235_at:104:651; Interrogation_Position=912; Antisense; TCACCCACACGCGTTTGTCGAAGAA
>probe:Drosophila_2:1627235_at:49:383; Interrogation_Position=934; Antisense; GAACGCATTCGATCTCTGTCTGGAA
>probe:Drosophila_2:1627235_at:486:331; Interrogation_Position=992; Antisense; GCGGACATAGTCCTGTACATACTGA

Paste this into a BLAST search page for me
GAAACTTTCCTACACTGCAAGAATGTGAAACTTTCCTACAGACACCTGCTGACACCTGCTGATTAGTCTTATCACTCACGTACGACCTGATCAACTCAAGAAGCCTCAAGCCTGGTCGTGATCACATCACTCGCAGAAATCCCTTTTTTGGCACACACTATTAGCAACCGTCATAGATAAGAGACCAGCTACCCATTGTGGGATTTCAATTTTCAGACGGGCAAGGAACCAAGTCTCGTACCGGAGCTGAAAATATGAGCCAACCATCACTGCCGTCACCCACACGCGTTTGTCGAAGAAGAACGCATTCGATCTCTGTCTGGAAGCGGACATAGTCCTGTACATACTGA

Full Affymetrix probeset data:

Annotations for 1627235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720