FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627237_at:

>probe:Drosophila_2:1627237_at:79:185; Interrogation_Position=1075; Antisense; AAAATGCTGCACCACTTGAAGCCGC
>probe:Drosophila_2:1627237_at:40:75; Interrogation_Position=1100; Antisense; AGGACTGCGGTAGCAAGCCCATCAA
>probe:Drosophila_2:1627237_at:179:345; Interrogation_Position=1136; Antisense; GCATAGCGTCGAGAGGTCCCTGTCC
>probe:Drosophila_2:1627237_at:415:109; Interrogation_Position=1261; Antisense; AGAAGGCGTGGCATGCACCGACCCA
>probe:Drosophila_2:1627237_at:352:35; Interrogation_Position=1285; Antisense; ATCAGTCTCTCCAGCACGGACGTGA
>probe:Drosophila_2:1627237_at:599:213; Interrogation_Position=1312; Antisense; AAGAGGACACCGTCGCACGATAGGT
>probe:Drosophila_2:1627237_at:680:455; Interrogation_Position=1330; Antisense; GATAGGTACGCATCCAAGCACAAGC
>probe:Drosophila_2:1627237_at:263:347; Interrogation_Position=1353; Antisense; GCATCCACCAAAGAACTGTCAGCTG
>probe:Drosophila_2:1627237_at:168:15; Interrogation_Position=1420; Antisense; ATTAGCCACATGAAGCGGCTGCCCA
>probe:Drosophila_2:1627237_at:688:287; Interrogation_Position=1435; Antisense; CGGCTGCCCAAGAATCTGAACTGCA
>probe:Drosophila_2:1627237_at:98:85; Interrogation_Position=1466; Antisense; AGTGTTGCAGTTGCGATTGCCCCAC
>probe:Drosophila_2:1627237_at:547:335; Interrogation_Position=950; Antisense; GCTGCTGTGAGTTGTGCACTTGCAA
>probe:Drosophila_2:1627237_at:474:167; Interrogation_Position=973; Antisense; AAATGTCCCGCCATGCAAAAGAGTC
>probe:Drosophila_2:1627237_at:253:53; Interrogation_Position=985; Antisense; ATGCAAAAGAGTCCGCCCAAGCCGT

Paste this into a BLAST search page for me
AAAATGCTGCACCACTTGAAGCCGCAGGACTGCGGTAGCAAGCCCATCAAGCATAGCGTCGAGAGGTCCCTGTCCAGAAGGCGTGGCATGCACCGACCCAATCAGTCTCTCCAGCACGGACGTGAAAGAGGACACCGTCGCACGATAGGTGATAGGTACGCATCCAAGCACAAGCGCATCCACCAAAGAACTGTCAGCTGATTAGCCACATGAAGCGGCTGCCCACGGCTGCCCAAGAATCTGAACTGCAAGTGTTGCAGTTGCGATTGCCCCACGCTGCTGTGAGTTGTGCACTTGCAAAAATGTCCCGCCATGCAAAAGAGTCATGCAAAAGAGTCCGCCCAAGCCGT

Full Affymetrix probeset data:

Annotations for 1627237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720