FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627238_at:

>probe:Drosophila_2:1627238_at:679:367; Interrogation_Position=310; Antisense; GAATCCTTCTGGAAGCGCTGCAAAA
>probe:Drosophila_2:1627238_at:356:207; Interrogation_Position=349; Antisense; AAGCGGAGCTGGATGCCTTTGAGCA
>probe:Drosophila_2:1627238_at:374:177; Interrogation_Position=380; Antisense; AAACGATCGAGATGGCTATGCGGCT
>probe:Drosophila_2:1627238_at:271:541; Interrogation_Position=510; Antisense; GGTTTTGCCATGTGTGCCAGAGAAA
>probe:Drosophila_2:1627238_at:181:179; Interrogation_Position=532; Antisense; AAACATTGCTGTTTCTGCAGAGCGA
>probe:Drosophila_2:1627238_at:250:417; Interrogation_Position=555; Antisense; GAGGGAATACCCACGGAGTCGCCAC
>probe:Drosophila_2:1627238_at:295:639; Interrogation_Position=580; Antisense; TCTACCAGACTCTCCTTGGGAAATT
>probe:Drosophila_2:1627238_at:709:593; Interrogation_Position=608; Antisense; TGGGCAAAGCGATGGACTTCTGCAC
>probe:Drosophila_2:1627238_at:92:587; Interrogation_Position=620; Antisense; TGGACTTCTGCACGCCTGAGAGCAA
>probe:Drosophila_2:1627238_at:545:81; Interrogation_Position=650; Antisense; AGGGCAGGAACTCCTCCTCATTCTA
>probe:Drosophila_2:1627238_at:394:281; Interrogation_Position=666; Antisense; CTCATTCTAGTCACTTTGCTGCGAT
>probe:Drosophila_2:1627238_at:421:693; Interrogation_Position=680; Antisense; TTTGCTGCGATCTCATTGCAAGTAA
>probe:Drosophila_2:1627238_at:131:357; Interrogation_Position=755; Antisense; GCAACACAGGGATCTGGGTATTCCT
>probe:Drosophila_2:1627238_at:199:529; Interrogation_Position=770; Antisense; GGGTATTCCTAAGCTATTTACTCTA

Paste this into a BLAST search page for me
GAATCCTTCTGGAAGCGCTGCAAAAAAGCGGAGCTGGATGCCTTTGAGCAAAACGATCGAGATGGCTATGCGGCTGGTTTTGCCATGTGTGCCAGAGAAAAAACATTGCTGTTTCTGCAGAGCGAGAGGGAATACCCACGGAGTCGCCACTCTACCAGACTCTCCTTGGGAAATTTGGGCAAAGCGATGGACTTCTGCACTGGACTTCTGCACGCCTGAGAGCAAAGGGCAGGAACTCCTCCTCATTCTACTCATTCTAGTCACTTTGCTGCGATTTTGCTGCGATCTCATTGCAAGTAAGCAACACAGGGATCTGGGTATTCCTGGGTATTCCTAAGCTATTTACTCTA

Full Affymetrix probeset data:

Annotations for 1627238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720