Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627240_at:

>probe:Drosophila_2:1627240_at:600:87; Interrogation_Position=106; Antisense; AGTCGTCGCGATATTTGGGTGCCCA
>probe:Drosophila_2:1627240_at:488:503; Interrogation_Position=131; Antisense; GTCCCGCCATTATACTGCATCAGAT
>probe:Drosophila_2:1627240_at:722:547; Interrogation_Position=168; Antisense; GGATGTGTCCGATGAATCAACTCTG
>probe:Drosophila_2:1627240_at:663:333; Interrogation_Position=18; Antisense; GCAGGCCTTGCTTAACCACTTTTTA
>probe:Drosophila_2:1627240_at:153:565; Interrogation_Position=204; Antisense; GGAATCCAACCAGGCGTGGCGCGAA
>probe:Drosophila_2:1627240_at:552:545; Interrogation_Position=259; Antisense; GGAGTCGGTTTCGAGTTCGTGAACT
>probe:Drosophila_2:1627240_at:513:643; Interrogation_Position=289; Antisense; TCTCGCTACATGAGCTCCTTGAGCA
>probe:Drosophila_2:1627240_at:701:725; Interrogation_Position=307; Antisense; TTGAGCAGCACCCAGGATGACGATA
>probe:Drosophila_2:1627240_at:329:513; Interrogation_Position=343; Antisense; GTGATTGGTAATTCATCTTCCAGCA
>probe:Drosophila_2:1627240_at:82:237; Interrogation_Position=411; Antisense; AATTCAGTCTTACAGTTCCGGGTCG
>probe:Drosophila_2:1627240_at:346:55; Interrogation_Position=437; Antisense; ATGACGAGAACCTGATCCAGCACCT
>probe:Drosophila_2:1627240_at:700:303; Interrogation_Position=459; Antisense; CCTGGCGTAATCCAAATGCCTATTA
>probe:Drosophila_2:1627240_at:334:507; Interrogation_Position=499; Antisense; GTGCTTGAGAGCCTTATCCGATTTC
>probe:Drosophila_2:1627240_at:424:599; Interrogation_Position=95; Antisense; TGTCGAATACCAGTCGTCGCGATAT

Paste this into a BLAST search page for me
AGTCGTCGCGATATTTGGGTGCCCAGTCCCGCCATTATACTGCATCAGATGGATGTGTCCGATGAATCAACTCTGGCAGGCCTTGCTTAACCACTTTTTAGGAATCCAACCAGGCGTGGCGCGAAGGAGTCGGTTTCGAGTTCGTGAACTTCTCGCTACATGAGCTCCTTGAGCATTGAGCAGCACCCAGGATGACGATAGTGATTGGTAATTCATCTTCCAGCAAATTCAGTCTTACAGTTCCGGGTCGATGACGAGAACCTGATCCAGCACCTCCTGGCGTAATCCAAATGCCTATTAGTGCTTGAGAGCCTTATCCGATTTCTGTCGAATACCAGTCGTCGCGATAT

Full Affymetrix probeset data:

Annotations for 1627240_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime