Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627244_at:

>probe:Drosophila_2:1627244_at:677:477; Interrogation_Position=1420; Antisense; GTTTTATATTGTTCCACTCTCCGTA
>probe:Drosophila_2:1627244_at:343:469; Interrogation_Position=1430; Antisense; GTTCCACTCTCCGTATTATTTGATT
>probe:Drosophila_2:1627244_at:73:369; Interrogation_Position=1490; Antisense; GAATGCAAATTGTTTACTCACTGAT
>probe:Drosophila_2:1627244_at:531:445; Interrogation_Position=1512; Antisense; GATGAAATCTCACTGGTATTACCAT
>probe:Drosophila_2:1627244_at:129:393; Interrogation_Position=1594; Antisense; GAAAGCCACACAGTACTAGTCTCTA
>probe:Drosophila_2:1627244_at:252:491; Interrogation_Position=1630; Antisense; GTAAATATTCCAAGGGCCAGCCAAG
>probe:Drosophila_2:1627244_at:430:577; Interrogation_Position=1659; Antisense; GGCCGAGCATTCCACATAGTTGTAC
>probe:Drosophila_2:1627244_at:567:673; Interrogation_Position=1681; Antisense; TACCTGTTTCTGTACTGCATAGATA
>probe:Drosophila_2:1627244_at:523:127; Interrogation_Position=1737; Antisense; ACCACGCGCTTGTAGATGTCATTGT
>probe:Drosophila_2:1627244_at:539:61; Interrogation_Position=1752; Antisense; ATGTCATTGTTGTGTGCTGGCCGAA
>probe:Drosophila_2:1627244_at:222:509; Interrogation_Position=1765; Antisense; GTGCTGGCCGAAAGTGTCAATTGTT
>probe:Drosophila_2:1627244_at:314:443; Interrogation_Position=1805; Antisense; GATGTAGGCGCATACGCTCACAAGA
>probe:Drosophila_2:1627244_at:688:715; Interrogation_Position=1885; Antisense; TTCGGGCTAGTGGTCAGTAGGTCTT
>probe:Drosophila_2:1627244_at:499:681; Interrogation_Position=1925; Antisense; TATGTATACACACGCAACTCACTCA

Paste this into a BLAST search page for me
GTTTTATATTGTTCCACTCTCCGTAGTTCCACTCTCCGTATTATTTGATTGAATGCAAATTGTTTACTCACTGATGATGAAATCTCACTGGTATTACCATGAAAGCCACACAGTACTAGTCTCTAGTAAATATTCCAAGGGCCAGCCAAGGGCCGAGCATTCCACATAGTTGTACTACCTGTTTCTGTACTGCATAGATAACCACGCGCTTGTAGATGTCATTGTATGTCATTGTTGTGTGCTGGCCGAAGTGCTGGCCGAAAGTGTCAATTGTTGATGTAGGCGCATACGCTCACAAGATTCGGGCTAGTGGTCAGTAGGTCTTTATGTATACACACGCAACTCACTCA

Full Affymetrix probeset data:

Annotations for 1627244_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime