Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627246_at:

>probe:Drosophila_2:1627246_at:346:551; Interrogation_Position=2228; Antisense; GGAGAAGCTGGCCACGTCCTTTGCA
>probe:Drosophila_2:1627246_at:562:303; Interrogation_Position=2325; Antisense; CCGGACTACTACGATCACATTAAAT
>probe:Drosophila_2:1627246_at:124:131; Interrogation_Position=2359; Antisense; ACCTGAAGACCATGGGCGAGCGCCT
>probe:Drosophila_2:1627246_at:442:603; Interrogation_Position=2413; Antisense; TGTTCATGGCGGACATGGCGCGCAT
>probe:Drosophila_2:1627246_at:3:697; Interrogation_Position=2438; Antisense; TTTCTCCAACTGTCGGTTCTACAAT
>probe:Drosophila_2:1627246_at:162:245; Interrogation_Position=2460; Antisense; AATTCGCCCGACACCGAGTATTATC
>probe:Drosophila_2:1627246_at:589:89; Interrogation_Position=2476; Antisense; AGTATTATCGGTGTGCCAACTCCCT
>probe:Drosophila_2:1627246_at:621:665; Interrogation_Position=2508; Antisense; TACTTCCAGACCAAGATGCGCGAGC
>probe:Drosophila_2:1627246_at:124:605; Interrogation_Position=2550; Antisense; TGATGCAGTGATTCCGAGGAGCCCT
>probe:Drosophila_2:1627246_at:555:553; Interrogation_Position=2567; Antisense; GGAGCCCTGCATAAGGCCGAACATT
>probe:Drosophila_2:1627246_at:557:703; Interrogation_Position=2623; Antisense; TTATTTTTAGAATTCTCCCCAGCTA
>probe:Drosophila_2:1627246_at:473:677; Interrogation_Position=2687; Antisense; TAGGTTAAGCTCAGTGTGTCCGTCT
>probe:Drosophila_2:1627246_at:692:497; Interrogation_Position=2708; Antisense; GTCTTGTTCACAGACGCGTTGTGTC
>probe:Drosophila_2:1627246_at:165:239; Interrogation_Position=2746; Antisense; AATCAGATCTATCGCCTACTCATTA

Paste this into a BLAST search page for me
GGAGAAGCTGGCCACGTCCTTTGCACCGGACTACTACGATCACATTAAATACCTGAAGACCATGGGCGAGCGCCTTGTTCATGGCGGACATGGCGCGCATTTTCTCCAACTGTCGGTTCTACAATAATTCGCCCGACACCGAGTATTATCAGTATTATCGGTGTGCCAACTCCCTTACTTCCAGACCAAGATGCGCGAGCTGATGCAGTGATTCCGAGGAGCCCTGGAGCCCTGCATAAGGCCGAACATTTTATTTTTAGAATTCTCCCCAGCTATAGGTTAAGCTCAGTGTGTCCGTCTGTCTTGTTCACAGACGCGTTGTGTCAATCAGATCTATCGCCTACTCATTA

Full Affymetrix probeset data:

Annotations for 1627246_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime