FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627248_at:

>probe:Drosophila_2:1627248_at:365:505; Interrogation_Position=1154; Antisense; GTCCATATCCAAATCCTCAGGTCTC
>probe:Drosophila_2:1627248_at:38:281; Interrogation_Position=1169; Antisense; CTCAGGTCTCAAAGGAATGCTCGCT
>probe:Drosophila_2:1627248_at:568:619; Interrogation_Position=1186; Antisense; TGCTCGCTGGGAAGAAATTAACGTC
>probe:Drosophila_2:1627248_at:16:43; Interrogation_Position=1224; Antisense; ATCGCGAAAAGTGACGCCTATTTGA
>probe:Drosophila_2:1627248_at:147:1; Interrogation_Position=1359; Antisense; GGGACTTTTTAATGGACCTGTTATG
>probe:Drosophila_2:1627248_at:572:163; Interrogation_Position=1456; Antisense; AAATTTATCGTTACCACATATCATG
>probe:Drosophila_2:1627248_at:288:149; Interrogation_Position=1471; Antisense; ACATATCATGGCAGACGGAGTCGGC
>probe:Drosophila_2:1627248_at:571:431; Interrogation_Position=1488; Antisense; GAGTCGGCGGAGTTAGTTCACATAT
>probe:Drosophila_2:1627248_at:80:669; Interrogation_Position=1530; Antisense; TACTACCTATGTACCCGTAACTGTT
>probe:Drosophila_2:1627248_at:292:691; Interrogation_Position=1591; Antisense; TTTGTATCGGCAGCTTTTCCACATA
>probe:Drosophila_2:1627248_at:263:23; Interrogation_Position=1644; Antisense; ATATCGTACTTATACCTATAGTTGA
>probe:Drosophila_2:1627248_at:65:613; Interrogation_Position=1666; Antisense; TGAAAAACTAACCACGCACGTATCT
>probe:Drosophila_2:1627248_at:657:291; Interrogation_Position=1684; Antisense; CGTATCTCATCTCAGTTCCATATAA
>probe:Drosophila_2:1627248_at:93:389; Interrogation_Position=1711; Antisense; GAAAACCTATTAAAGCTACACTCTT

Paste this into a BLAST search page for me
GTCCATATCCAAATCCTCAGGTCTCCTCAGGTCTCAAAGGAATGCTCGCTTGCTCGCTGGGAAGAAATTAACGTCATCGCGAAAAGTGACGCCTATTTGAGGGACTTTTTAATGGACCTGTTATGAAATTTATCGTTACCACATATCATGACATATCATGGCAGACGGAGTCGGCGAGTCGGCGGAGTTAGTTCACATATTACTACCTATGTACCCGTAACTGTTTTTGTATCGGCAGCTTTTCCACATAATATCGTACTTATACCTATAGTTGATGAAAAACTAACCACGCACGTATCTCGTATCTCATCTCAGTTCCATATAAGAAAACCTATTAAAGCTACACTCTT

Full Affymetrix probeset data:

Annotations for 1627248_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720