Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627249_a_at:

>probe:Drosophila_2:1627249_a_at:706:115; Interrogation_Position=384; Antisense; AGCTATCCGGATTCATAAACTGTCG
>probe:Drosophila_2:1627249_a_at:289:663; Interrogation_Position=399; Antisense; TAAACTGTCGCGAGGACTCTCCAGA
>probe:Drosophila_2:1627249_a_at:153:671; Interrogation_Position=449; Antisense; TACGAGACAGGATCCTCAGCCAGGT
>probe:Drosophila_2:1627249_a_at:457:649; Interrogation_Position=464; Antisense; TCAGCCAGGTTGTCATTCGCAAAGA
>probe:Drosophila_2:1627249_a_at:511:109; Interrogation_Position=486; Antisense; AGAAGAACGCCAGTGCAGTCAATGT
>probe:Drosophila_2:1627249_a_at:557:47; Interrogation_Position=588; Antisense; ATCCGGCTGGTCTGCGTGTCTGTAG
>probe:Drosophila_2:1627249_a_at:649:499; Interrogation_Position=605; Antisense; GTCTGTAGCACCACGGGCAAGCGCA
>probe:Drosophila_2:1627249_a_at:445:71; Interrogation_Position=630; Antisense; AGGCGTGCAAAAACTGCTCCTGCGG
>probe:Drosophila_2:1627249_a_at:135:559; Interrogation_Position=722; Antisense; GGAAATTGTTATCTCGGCGACGCCT
>probe:Drosophila_2:1627249_a_at:364:319; Interrogation_Position=778; Antisense; GCCCGCCTTTAAGCCCGGTGAGAAG
>probe:Drosophila_2:1627249_a_at:65:397; Interrogation_Position=815; Antisense; GACAACCTCCTGAAATCCGACATTT
>probe:Drosophila_2:1627249_a_at:16:303; Interrogation_Position=831; Antisense; CCGACATTTAACTTAGGCTCACCAT
>probe:Drosophila_2:1627249_a_at:424:571; Interrogation_Position=846; Antisense; GGCTCACCATGGTATACCCAATCAA
>probe:Drosophila_2:1627249_a_at:134:167; Interrogation_Position=936; Antisense; AAATGCACCGCGTCATAAACACAGC

Paste this into a BLAST search page for me
AGCTATCCGGATTCATAAACTGTCGTAAACTGTCGCGAGGACTCTCCAGATACGAGACAGGATCCTCAGCCAGGTTCAGCCAGGTTGTCATTCGCAAAGAAGAAGAACGCCAGTGCAGTCAATGTATCCGGCTGGTCTGCGTGTCTGTAGGTCTGTAGCACCACGGGCAAGCGCAAGGCGTGCAAAAACTGCTCCTGCGGGGAAATTGTTATCTCGGCGACGCCTGCCCGCCTTTAAGCCCGGTGAGAAGGACAACCTCCTGAAATCCGACATTTCCGACATTTAACTTAGGCTCACCATGGCTCACCATGGTATACCCAATCAAAAATGCACCGCGTCATAAACACAGC

Full Affymetrix probeset data:

Annotations for 1627249_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime