FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627250_at:

>probe:Drosophila_2:1627250_at:105:609; Interrogation_Position=102; Antisense; TGAGCACACTTCTGCCTCCAAAAGT
>probe:Drosophila_2:1627250_at:213:149; Interrogation_Position=109; Antisense; ACTTCTGCCTCCAAAAGTTACAGGA
>probe:Drosophila_2:1627250_at:519:267; Interrogation_Position=129; Antisense; CAGGAGGTCCGAAAGTTGTCGCCAA
>probe:Drosophila_2:1627250_at:637:61; Interrogation_Position=13; Antisense; ATGTGCGCGTCTGCTTGGGTTTCAC
>probe:Drosophila_2:1627250_at:487:391; Interrogation_Position=139; Antisense; GAAAGTTGTCGCCAACGAGCCAAAA
>probe:Drosophila_2:1627250_at:147:599; Interrogation_Position=145; Antisense; TGTCGCCAACGAGCCAAAATCGCAG
>probe:Drosophila_2:1627250_at:107:313; Interrogation_Position=157; Antisense; GCCAAAATCGCAGACCGAAGACTGA
>probe:Drosophila_2:1627250_at:509:499; Interrogation_Position=21; Antisense; GTCTGCTTGGGTTTCACCGCAATTC
>probe:Drosophila_2:1627250_at:333:697; Interrogation_Position=32; Antisense; TTTCACCGCAATTCCGCTTACGGAA
>probe:Drosophila_2:1627250_at:366:629; Interrogation_Position=44; Antisense; TCCGCTTACGGAATTGAGGCACTGG
>probe:Drosophila_2:1627250_at:1:357; Interrogation_Position=62; Antisense; GCACTGGAAGTCAAGCAGAGTGCTC
>probe:Drosophila_2:1627250_at:585:209; Interrogation_Position=74; Antisense; AAGCAGAGTGCTCGCAAGTTCCAAA
>probe:Drosophila_2:1627250_at:469:85; Interrogation_Position=80; Antisense; AGTGCTCGCAAGTTCCAAAAGTTGA
>probe:Drosophila_2:1627250_at:659:183; Interrogation_Position=96; Antisense; AAAAGTTGAGCACACTTCTGCCTCC

Paste this into a BLAST search page for me
TGAGCACACTTCTGCCTCCAAAAGTACTTCTGCCTCCAAAAGTTACAGGACAGGAGGTCCGAAAGTTGTCGCCAAATGTGCGCGTCTGCTTGGGTTTCACGAAAGTTGTCGCCAACGAGCCAAAATGTCGCCAACGAGCCAAAATCGCAGGCCAAAATCGCAGACCGAAGACTGAGTCTGCTTGGGTTTCACCGCAATTCTTTCACCGCAATTCCGCTTACGGAATCCGCTTACGGAATTGAGGCACTGGGCACTGGAAGTCAAGCAGAGTGCTCAAGCAGAGTGCTCGCAAGTTCCAAAAGTGCTCGCAAGTTCCAAAAGTTGAAAAAGTTGAGCACACTTCTGCCTCC

Full Affymetrix probeset data:

Annotations for 1627250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720