Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627253_at:

>probe:Drosophila_2:1627253_at:238:189; Interrogation_Position=2582; Antisense; AACGTTTGTGCAGGTCAAGTCCCAG
>probe:Drosophila_2:1627253_at:213:107; Interrogation_Position=2630; Antisense; AGAACCGGATCTCGATGCACTCAGT
>probe:Drosophila_2:1627253_at:617:53; Interrogation_Position=2644; Antisense; ATGCACTCAGTGCTTTTCCAGGTTA
>probe:Drosophila_2:1627253_at:219:697; Interrogation_Position=2657; Antisense; TTTTCCAGGTTACACAGGTCTCTCG
>probe:Drosophila_2:1627253_at:580:713; Interrogation_Position=2691; Antisense; TTCAGTCGACAGTTGATAGCCCGCG
>probe:Drosophila_2:1627253_at:210:325; Interrogation_Position=2805; Antisense; GCGCAGCTACCCAATCATTTGCAAA
>probe:Drosophila_2:1627253_at:334:695; Interrogation_Position=2848; Antisense; TTTCGGCCTCTAATATGCACAGTGC
>probe:Drosophila_2:1627253_at:142:657; Interrogation_Position=2891; Antisense; TAAGGACTTTTTTGGCCGCATTACT
>probe:Drosophila_2:1627253_at:24:235; Interrogation_Position=2920; Antisense; AATCGACTTCGACAAACTCAGCTGA
>probe:Drosophila_2:1627253_at:202:213; Interrogation_Position=2970; Antisense; AAGAGTCCTATTTGGTATCGCTATA
>probe:Drosophila_2:1627253_at:238:433; Interrogation_Position=2997; Antisense; GAGGGTTTCAACAATGCCGTTCGCA
>probe:Drosophila_2:1627253_at:414:99; Interrogation_Position=3023; Antisense; AGATGTTCACATTCACGAGCTGCTT
>probe:Drosophila_2:1627253_at:651:335; Interrogation_Position=3041; Antisense; GCTGCTTTAACCCACATCTATTGAT
>probe:Drosophila_2:1627253_at:259:603; Interrogation_Position=3062; Antisense; TGATTTCCCACTCAAGACTTTTACC

Paste this into a BLAST search page for me
AACGTTTGTGCAGGTCAAGTCCCAGAGAACCGGATCTCGATGCACTCAGTATGCACTCAGTGCTTTTCCAGGTTATTTTCCAGGTTACACAGGTCTCTCGTTCAGTCGACAGTTGATAGCCCGCGGCGCAGCTACCCAATCATTTGCAAATTTCGGCCTCTAATATGCACAGTGCTAAGGACTTTTTTGGCCGCATTACTAATCGACTTCGACAAACTCAGCTGAAAGAGTCCTATTTGGTATCGCTATAGAGGGTTTCAACAATGCCGTTCGCAAGATGTTCACATTCACGAGCTGCTTGCTGCTTTAACCCACATCTATTGATTGATTTCCCACTCAAGACTTTTACC

Full Affymetrix probeset data:

Annotations for 1627253_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime