FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627254_at:

>probe:Drosophila_2:1627254_at:576:21; Interrogation_Position=1007; Antisense; ATAGACGACTTTGTGGAGTGGTGCC
>probe:Drosophila_2:1627254_at:216:85; Interrogation_Position=1023; Antisense; AGTGGTGCCAGGAGAACGATCATCT
>probe:Drosophila_2:1627254_at:24:115; Interrogation_Position=1080; Antisense; AGCAGCAGTCCAGTGCTAGCTCCAG
>probe:Drosophila_2:1627254_at:27:509; Interrogation_Position=1092; Antisense; GTGCTAGCTCCAGCTCCCAAAAGAA
>probe:Drosophila_2:1627254_at:441:183; Interrogation_Position=1110; Antisense; AAAAGAACATATCCAGCGCCTACCA
>probe:Drosophila_2:1627254_at:341:265; Interrogation_Position=1133; Antisense; CAGACCTCGCACAGTACAAACATGA
>probe:Drosophila_2:1627254_at:94:551; Interrogation_Position=1238; Antisense; GGAGAATCTAAGCACGGCCGGTAAA
>probe:Drosophila_2:1627254_at:406:659; Interrogation_Position=1246; Antisense; TAAGCACGGCCGGTAAATTTACATT
>probe:Drosophila_2:1627254_at:486:301; Interrogation_Position=1321; Antisense; CCCGGCGTCCTATTCATTGAAATTG
>probe:Drosophila_2:1627254_at:52:107; Interrogation_Position=1354; Antisense; AGACAACATCTAGTTCATCCGTTAG
>probe:Drosophila_2:1627254_at:75:699; Interrogation_Position=1448; Antisense; TTATTTCGTTGCTTATGACTAGACA
>probe:Drosophila_2:1627254_at:383:401; Interrogation_Position=1469; Antisense; GACATAAATCACATCCCTCTGGTAT
>probe:Drosophila_2:1627254_at:265:153; Interrogation_Position=1479; Antisense; ACATCCCTCTGGTATTATTTTAGTA
>probe:Drosophila_2:1627254_at:38:243; Interrogation_Position=1517; Antisense; AATTTTTACGTTCTTCTATCATTGA

Paste this into a BLAST search page for me
ATAGACGACTTTGTGGAGTGGTGCCAGTGGTGCCAGGAGAACGATCATCTAGCAGCAGTCCAGTGCTAGCTCCAGGTGCTAGCTCCAGCTCCCAAAAGAAAAAAGAACATATCCAGCGCCTACCACAGACCTCGCACAGTACAAACATGAGGAGAATCTAAGCACGGCCGGTAAATAAGCACGGCCGGTAAATTTACATTCCCGGCGTCCTATTCATTGAAATTGAGACAACATCTAGTTCATCCGTTAGTTATTTCGTTGCTTATGACTAGACAGACATAAATCACATCCCTCTGGTATACATCCCTCTGGTATTATTTTAGTAAATTTTTACGTTCTTCTATCATTGA

Full Affymetrix probeset data:

Annotations for 1627254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720